ID: 1013819174

View in Genome Browser
Species Human (GRCh38)
Location 6:114134729-114134751
Sequence CCTTCTATGCTGGGACTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013819174 Original CRISPR CCTTCTATGCTGGGACTGCC AGG Intronic
900524474 1:3121763-3121785 CCTTCTCTGCGGGGCCGGCCAGG + Intronic
902891703 1:19448888-19448910 CCCTGTATCCTGGAACTGCCTGG + Intronic
903415530 1:23179986-23180008 CCCTCTTTGCTTTGACTGCCAGG - Intergenic
905183484 1:36180136-36180158 CCTTCTCTTCTGGCTCTGCCAGG + Intronic
905363319 1:37434973-37434995 CCTTCCACCCTGGGACTGCCTGG + Intergenic
906798925 1:48719351-48719373 CCTTAAGTGCTGGCACTGCCAGG - Intronic
909433151 1:75613308-75613330 CCAACTAAACTGGGACTGCCTGG - Intergenic
909609180 1:77535080-77535102 CCAACTATCCTGAGACTGCCAGG - Intronic
915776869 1:158499855-158499877 CCTTTGATGATGGTACTGCCTGG + Intergenic
915980560 1:160417328-160417350 CCTTCGCTCCTGGGACAGCCTGG - Intronic
919725532 1:200880339-200880361 CATTCACTGCTGGGACTACCAGG - Intergenic
920182266 1:204139363-204139385 TCGTCTAAGCTGGGTCTGCCTGG + Intronic
1067473848 10:46553835-46553857 CCTTCTGAGCTGGGAAGGCCAGG - Intronic
1067685037 10:48461613-48461635 CCTTCTTTGCCTGGGCTGCCAGG - Intronic
1067718553 10:48708864-48708886 CCTTCTATGATGGGTCTGTAAGG - Intronic
1069368795 10:67722018-67722040 CCTTCTATGTTGGTCTTGCCGGG + Intergenic
1071819710 10:89267410-89267432 CTCTCCCTGCTGGGACTGCCTGG - Intronic
1072543955 10:96419891-96419913 CCCTCTTTGCTGTGACTGCTAGG + Intronic
1072721945 10:97786670-97786692 CTTTCTGAGCTTGGACTGCCTGG + Intergenic
1075093283 10:119455142-119455164 CCTGCTCTGGTGGGGCTGCCAGG + Exonic
1075652141 10:124134445-124134467 ACCCCTTTGCTGGGACTGCCCGG + Intergenic
1077168734 11:1156983-1157005 CTTTCTGTGCTGGGACTGCTCGG + Intergenic
1078450284 11:11435947-11435969 TCTTCTCTCCTGGGACTGCTGGG + Intronic
1081447365 11:43143877-43143899 CCTTCTTGGGTGGGACTGCCTGG + Intergenic
1083817516 11:65143989-65144011 CCTTCCAGGCTGGGAGTACCTGG - Intergenic
1084439064 11:69160530-69160552 ACTCCTCTACTGGGACTGCCTGG + Intergenic
1086281980 11:85200561-85200583 CCATCTATGCAGGGACTTGCTGG + Intronic
1088113824 11:106294279-106294301 CCTTCAATGCTTGGAGTCCCAGG - Intergenic
1088740407 11:112762408-112762430 CCTTCTATGCTGGGAGAGGATGG + Intergenic
1091364701 11:135007915-135007937 CCTTCTTTGCTGGGAGTTCTGGG + Intergenic
1094174003 12:27523677-27523699 CCTTTTATCCTGGGACTGCTGGG - Intronic
1099202373 12:79690992-79691014 CCTCCTGTCCTGGGATTGCCTGG - Exonic
1099537198 12:83858645-83858667 CCTGCTCTGCTGGGATTGGCTGG - Intergenic
1099945563 12:89239714-89239736 CCTTCATTGCTATGACTGCCAGG + Intergenic
1102244464 12:111346618-111346640 CCTTCAATGCTGTGGCTCCCTGG - Intronic
1103075765 12:117981286-117981308 CCACCTCTGCTGTGACTGCCTGG + Intergenic
1108830651 13:54474072-54474094 CCTTCTAGGGTAGGACTGTCAGG - Intergenic
1113864046 13:113509398-113509420 CTGTCTATGTTGGGACTGGCGGG + Intronic
1119414521 14:74460614-74460636 CCTTCCATCCTGGGCCAGCCTGG + Intergenic
1119517619 14:75260651-75260673 CCTTCTGTCCTGACACTGCCAGG + Intronic
1121929632 14:97960625-97960647 CCTTCTGCGCTTGGGCTGCCAGG + Intronic
1122064314 14:99161128-99161150 CCTTTTTTGCTGAGACTGCTAGG - Intergenic
1122984907 14:105207564-105207586 CCTTCCGGGCTGGGCCTGCCAGG - Intergenic
1125476468 15:40051053-40051075 TCTTCTCTGCTGCGATTGCCAGG - Intergenic
1127084005 15:55408095-55408117 CCTCCTAGGCTGGGGCTGCTCGG - Intronic
1129115477 15:73363182-73363204 CCTTCTTTGCTGGGCTTTCCTGG - Intronic
1130211253 15:81924821-81924843 CCTTCCATGCTTGGTCTACCTGG + Intergenic
1131455640 15:92580466-92580488 CCCCCTCTGCTGGGCCTGCCTGG + Intergenic
1132783642 16:1642330-1642352 CCTGCTGTGCTGGGACTGGAGGG - Intronic
1134887742 16:17808899-17808921 CCTTGGAAGCTGGGACTCCCAGG - Intergenic
1135711133 16:24718194-24718216 CCTTCTCTGCTGGCAGTGCCTGG + Intergenic
1137445106 16:48526850-48526872 CCTTCTCAGCTGGGGCTTCCTGG + Intergenic
1137705965 16:50536023-50536045 GCATCTATGCTGGGACTGACAGG + Intergenic
1139048049 16:63087306-63087328 ACTTCTATGATTGGAGTGCCTGG - Intergenic
1139476306 16:67204208-67204230 CCCTCCATGCTGGGCCTGCAGGG + Intergenic
1141618369 16:85222706-85222728 CCGTCTCTGCGTGGACTGCCGGG + Intergenic
1143204770 17:5134012-5134034 CCATCTCTGCTGGGACTGTGTGG - Intronic
1143624455 17:8101564-8101586 CCTTATATCCTGGGAATGGCAGG - Intronic
1143923537 17:10349716-10349738 CCTTCTATCCTAGGCCTGCCTGG - Intronic
1144167589 17:12627278-12627300 ACCTCTGTGCTGGCACTGCCTGG + Intergenic
1146884968 17:36464553-36464575 CCTCCTGGGCTGGGTCTGCCTGG + Intergenic
1148846510 17:50533010-50533032 CCTTCCATGCCGCCACTGCCAGG - Intronic
1149671023 17:58410264-58410286 CCTTCTATTCTGTGGGTGCCAGG + Intronic
1155178844 18:23325474-23325496 CCTTCTTTGCTTTGGCTGCCAGG - Intronic
1157399379 18:47374358-47374380 CCTTCTCTGCATGGCCTGCCAGG - Intergenic
1157704669 18:49794287-49794309 CCATCTCTGCTGTGACTGCAGGG + Exonic
1160015069 18:75134002-75134024 CCCTCTGTGCTGGCACTGTCTGG - Intergenic
1161008892 19:1950632-1950654 CCTTCCATGTTGGGACGGACGGG + Intronic
1163177319 19:15573475-15573497 CCTGCTATGCTGGGCCTGGAGGG + Intergenic
1163192279 19:15686045-15686067 CCTACTAGGCTGGGAGTACCTGG - Intronic
1165483928 19:36083827-36083849 CCTACTCTCCTGGGGCTGCCTGG - Intronic
1167117318 19:47495847-47495869 CCTTCTCTCCTCGGGCTGCCAGG + Intronic
925203715 2:1989398-1989420 GCTTCTGTCCTGGGATTGCCGGG - Intronic
925564085 2:5230617-5230639 CATTCAACGCTGGGACTGGCTGG + Intergenic
937377801 2:121349559-121349581 ACTTCAATGCTGGCACTTCCTGG + Intronic
944066014 2:195619831-195619853 CATAGTATGCTGGGACTGGCAGG - Intronic
948265406 2:236632185-236632207 CCTGCTAGGCGGGGACTGGCAGG + Intergenic
948782203 2:240328805-240328827 CCTTCCATTCAGGGGCTGCCGGG - Intergenic
1169391883 20:5197362-5197384 CTGTCTGTGCTGGGAGTGCCAGG + Exonic
1170622069 20:18004597-18004619 CCTTCCATGATGGGACAGCTGGG - Intronic
1172031717 20:31986940-31986962 CCTTGGATGCTGGGTCTGCTTGG - Intronic
1172601526 20:36187161-36187183 CCTTCTTTGCTTTGGCTGCCAGG - Intronic
1172950912 20:38723084-38723106 CCATTCAGGCTGGGACTGCCAGG + Intergenic
1174112183 20:48204648-48204670 CCTCCTGTGCTGGGACATCCCGG - Intergenic
1176430063 21:6569955-6569977 CCTTCCAAGCTGGCACTGTCTGG - Intergenic
1176660779 21:9633616-9633638 CCCTCTATGCTGGATCTGCGAGG + Intergenic
1178471071 21:32893434-32893456 TCTTCTAGGCTGGGATTTCCTGG - Intergenic
1179180255 21:39038397-39038419 CCTTCTAGGCTGGGCATGGCAGG - Intergenic
1179705457 21:43177417-43177439 CCTTCCAAGCTGGCACTGTCTGG - Intergenic
1180234321 21:46448217-46448239 CCTTCAATTCTGGTACTACCTGG + Intergenic
1183784341 22:40020998-40021020 CCTTGTAAGCTGGGGCTCCCAGG - Intronic
1185171578 22:49297581-49297603 CCTTCTCTGCAGGGGGTGCCTGG - Intergenic
1185176879 22:49332903-49332925 CCTTCCTTGGTGGGAGTGCCTGG - Intergenic
950730569 3:14953033-14953055 CCTTCTATTCTAAGACTTCCAGG - Intronic
952020184 3:29009525-29009547 CCTTCCATGCTAGATCTGCCTGG + Intergenic
953239046 3:41132122-41132144 CCTTTTTTGCTTAGACTGCCAGG - Intergenic
954415697 3:50392260-50392282 CCAGCTATGCTCGGGCTGCCAGG - Intronic
955015182 3:55063339-55063361 CCTTCAAGGCTGAGACTGTCTGG - Intronic
955466663 3:59243978-59244000 CCTTCTGTGCTGGGAGTTCCTGG + Intergenic
957083092 3:75655546-75655568 CCTTCTCTGCTGGGCCAGCTCGG + Intergenic
957156476 3:76551010-76551032 CCTTCTAGGCAGGGACAGCTAGG + Intronic
961457827 3:127033006-127033028 CCTTCTCTGCTCGGCCTGGCAGG - Intronic
966488260 3:180496723-180496745 CTTTATATGCTGAGACTGCCAGG - Intergenic
967121598 3:186387177-186387199 CCATCCAGGCAGGGACTGCCTGG - Intergenic
968483560 4:848184-848206 CCTTCTGAGCTGGGTCAGCCTGG + Intergenic
969430557 4:7151398-7151420 CCTGCTGAGCTGGGACTACCAGG - Intergenic
970026059 4:11625322-11625344 CCTTCTATGCCGGGGCCACCTGG - Intergenic
972121757 4:35712439-35712461 CCTGCTATTCTGGGATTGGCTGG + Intergenic
982170250 4:152655238-152655260 CCTTCTTGGCTGAGACTGGCTGG + Intronic
986131046 5:4930515-4930537 CCTTCTTTGCTGGGGCTGCCAGG - Intergenic
988289708 5:29270086-29270108 CCTTCTGTGTTGGGTCTCCCTGG - Intergenic
988535429 5:32063662-32063684 CCTGGTATGTTGGCACTGCCTGG - Intronic
989169938 5:38464016-38464038 CCTTCTATTCTGAGAATCCCAGG + Exonic
990432544 5:55750676-55750698 CCTTCTGTGCTGATGCTGCCCGG - Intronic
991459799 5:66845880-66845902 TCTTCTGTGCTGGGACTTCAAGG + Intronic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
998478665 5:142443010-142443032 CCTTGTATTCTGGGCCTGACTGG - Intergenic
1001759375 5:174194780-174194802 CCTGCTCTGGTGGGACTGCTGGG - Intronic
1003363935 6:5454858-5454880 CTTCCTTTGCTGGGACTGCCTGG + Intronic
1006060379 6:31414476-31414498 CTTTCCATGCTGGGCCTGCTGGG + Intronic
1006072822 6:31509248-31509270 CTTTCCATGCTGGGCCTGCTGGG + Intronic
1006790931 6:36700800-36700822 CCTGCAAGGCTGGAACTGCCAGG + Intronic
1007119664 6:39369510-39369532 CCTTCTATGAGGGGACTGTCAGG - Intronic
1007498574 6:42278981-42279003 CCTTCTATGCCAGGGCTGCTAGG + Intronic
1008591902 6:53002228-53002250 CCTACTCTGCTGGCACTACCTGG + Exonic
1013819174 6:114134729-114134751 CCTTCTATGCTGGGACTGCCAGG + Intronic
1015844049 6:137499098-137499120 TGTGCTATTCTGGGACTGCCTGG - Intergenic
1024056387 7:45662233-45662255 CCTGCCATGCTGGAGCTGCCAGG + Intronic
1026505706 7:70980764-70980786 GATTCAGTGCTGGGACTGCCAGG - Intergenic
1034965558 7:155388636-155388658 CCTTCTAGTCTGGGCCTGCTGGG + Intronic
1035265110 7:157685894-157685916 CCTCCTCTGCTGGGACAGCGCGG - Intronic
1040861377 8:52002482-52002504 GCTTCTAAGGAGGGACTGCCTGG + Intergenic
1041336396 8:56789376-56789398 ACCTCTAGGCTGTGACTGCCTGG - Intergenic
1045573404 8:103393306-103393328 CTTCCTAGGCTGGGACTGCAAGG - Intergenic
1053656602 9:40222985-40223007 CCTGCGATCCTGGGGCTGCCCGG + Intergenic
1056678843 9:88699382-88699404 CCAGCTATGCTGGGGCTGCTGGG + Intergenic
1057217836 9:93239182-93239204 CCTTCGAGGCTGGGTCTGGCTGG + Intronic
1057521348 9:95762931-95762953 CCTCCTGTGATGGGACTCCCAGG - Intergenic
1058766008 9:108183343-108183365 CCTAGTTTCCTGGGACTGCCAGG + Intergenic
1059325262 9:113500453-113500475 GATGCTATCCTGGGACTGCCAGG + Intronic
1059469107 9:114490627-114490649 GCTTCCATGCTGCGAATGCCGGG + Intronic
1061425779 9:130497642-130497664 CCCTCTTTGCAGGGGCTGCCAGG + Intronic
1062207511 9:135345351-135345373 GCTTCTATGCTGCGTCTGCCTGG + Exonic
1203638347 Un_KI270750v1:135460-135482 CCCTCTATGCTGGATCTGCGAGG + Intergenic
1195060781 X:101191721-101191743 GCTTCTATCCTGGGCCGGCCGGG - Intergenic
1199606501 X:149583546-149583568 CCTTCACTGCTGACACTGCCTGG + Exonic
1199632621 X:149785822-149785844 CCTTCACTGCTGACACTGCCTGG - Exonic
1199947965 X:152682631-152682653 CCTTGACTGCTGGCACTGCCTGG - Intergenic
1199961714 X:152785823-152785845 CCTTGACTGCTGGCACTGCCTGG + Intergenic
1201277393 Y:12312270-12312292 CCTTAGATGCTGGGTCTTCCAGG - Intergenic