ID: 1013819674

View in Genome Browser
Species Human (GRCh38)
Location 6:114139282-114139304
Sequence CAACCACAGTAGCCCAAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013819674_1013819679 9 Left 1013819674 6:114139282-114139304 CCACTCTTGGGCTACTGTGGTTG 0: 1
1: 0
2: 2
3: 7
4: 141
Right 1013819679 6:114139314-114139336 AAGTAGGTGGGAAGAGCGGTTGG 0: 1
1: 0
2: 2
3: 18
4: 270
1013819674_1013819675 -7 Left 1013819674 6:114139282-114139304 CCACTCTTGGGCTACTGTGGTTG 0: 1
1: 0
2: 2
3: 7
4: 141
Right 1013819675 6:114139298-114139320 GTGGTTGAAGAGATTGAAGTAGG No data
1013819674_1013819676 -4 Left 1013819674 6:114139282-114139304 CCACTCTTGGGCTACTGTGGTTG 0: 1
1: 0
2: 2
3: 7
4: 141
Right 1013819676 6:114139301-114139323 GTTGAAGAGATTGAAGTAGGTGG No data
1013819674_1013819677 -3 Left 1013819674 6:114139282-114139304 CCACTCTTGGGCTACTGTGGTTG 0: 1
1: 0
2: 2
3: 7
4: 141
Right 1013819677 6:114139302-114139324 TTGAAGAGATTGAAGTAGGTGGG No data
1013819674_1013819678 5 Left 1013819674 6:114139282-114139304 CCACTCTTGGGCTACTGTGGTTG 0: 1
1: 0
2: 2
3: 7
4: 141
Right 1013819678 6:114139310-114139332 ATTGAAGTAGGTGGGAAGAGCGG 0: 1
1: 0
2: 1
3: 42
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013819674 Original CRISPR CAACCACAGTAGCCCAAGAG TGG (reversed) Intronic
902400428 1:16154209-16154231 CAACCACAGTCCCCCAGGAAGGG + Intronic
902447434 1:16476133-16476155 CAGCCACAATAGCCCAGGGGAGG + Intergenic
903868366 1:26414261-26414283 CAACCCCAGCAGCCAAAGAATGG - Intronic
904835334 1:33332039-33332061 CAACCACAGGATCCCAAGAATGG - Intronic
905775843 1:40666620-40666642 AAAACACTGGAGCCCAAGAGTGG - Intergenic
907288217 1:53395773-53395795 CAACTGCAGAAGCCCAAGAAGGG - Intergenic
908273816 1:62448074-62448096 CAACCTCAGTAGGCCAGGCGCGG - Intronic
909433565 1:75616104-75616126 CGTCCACAGCAGCGCAAGAGGGG - Intergenic
912327259 1:108779078-108779100 AAATCTGAGTAGCCCAAGAGAGG - Intronic
912625151 1:111200199-111200221 TGACCACACTAGCCCCAGAGAGG + Intronic
914984986 1:152448695-152448717 TAGCCACAGTAGCCCCAGAAAGG - Intergenic
918102285 1:181386913-181386935 CAAAAACAAAAGCCCAAGAGCGG - Intergenic
919765931 1:201127352-201127374 CAATCACAGGAGGCCAGGAGTGG - Intergenic
920295474 1:204953604-204953626 CACACCCTGTAGCCCAAGAGTGG - Intronic
920305493 1:205015681-205015703 CAAGCACAGGTGCGCAAGAGTGG - Intronic
920917863 1:210272644-210272666 AAAAGACAGTAGCCCAATAGGGG - Intergenic
921213930 1:212921582-212921604 CAACCACAGGAGCTCAATAGAGG + Intergenic
924646335 1:245880879-245880901 CAATCACAGTTGCCCAAGAGTGG + Intronic
924696024 1:246400686-246400708 CAACTACAGTAGCCTGAAAGGGG - Intronic
1063351001 10:5354998-5355020 CAGCCACAGAAGTCCAATAGAGG - Intergenic
1064932089 10:20639647-20639669 CAACCATAGAGGCACAAGAGGGG + Intergenic
1066635396 10:37494534-37494556 GACCCACAGTGGCCCAATAGCGG + Intergenic
1069309403 10:67015310-67015332 CAACATCAGTAGCTCAAGAATGG - Intronic
1074022096 10:109594468-109594490 GAACCACAGCAGCCCTAAAGTGG + Intergenic
1074024183 10:109616582-109616604 CAACCACAGAAGCAGAGGAGAGG + Intergenic
1076003079 10:126927849-126927871 CAGCCACAGCAACCCAAGGGTGG - Intronic
1081286427 11:41275459-41275481 CAAACACAGAAGCAGAAGAGTGG + Intronic
1081416191 11:42819077-42819099 CAACCAAAATAGCCTAAAAGAGG + Intergenic
1081654104 11:44845978-44846000 CAATAACAGTGGCCCAGGAGGGG - Intronic
1081744633 11:45464285-45464307 CAGCCACAGGAGCCAGAGAGAGG + Intergenic
1081838174 11:46175084-46175106 CAAGCACAGTGGCTCAAGACTGG - Intergenic
1085505897 11:77058738-77058760 TATTCACAGTAGCCAAAGAGTGG + Intergenic
1086536691 11:87855396-87855418 CAACCTCAGTAAGCCAATAGAGG - Intergenic
1087890391 11:103531435-103531457 CACTCACAGTCACCCAAGAGTGG + Intergenic
1089848743 11:121479311-121479333 CAAACACGGTAACACAAGAGTGG - Intronic
1095821726 12:46486016-46486038 AAACCACAGTAGCCCAGCTGTGG - Intergenic
1098898076 12:76084890-76084912 GAACCAGAGGAGCCCAAGCGCGG - Exonic
1101066635 12:101028063-101028085 AAACCACAGCAGCCCTACAGAGG + Intronic
1102106250 12:110326284-110326306 CACTAACAGTATCCCAAGAGTGG + Intronic
1102603571 12:114051740-114051762 CAGCCACAGTGGACCAAGATGGG - Intergenic
1102999964 12:117377748-117377770 CTGCCACAGTTGCCCAAGTGAGG + Intronic
1103021600 12:117539024-117539046 AAACCACAGTGTCCCATGAGTGG + Intronic
1103138377 12:118527484-118527506 CATCCACAGATGTCCAAGAGCGG - Intergenic
1103463091 12:121120789-121120811 TATCCACAGTAGCCAAAAAGTGG + Intergenic
1104749030 12:131226934-131226956 AGAACACAGAAGCCCAAGAGGGG + Intergenic
1104784093 12:131438630-131438652 AGAACACAGAAGCCCAAGAGGGG - Intergenic
1106570675 13:30924576-30924598 CATCCACAGAAGCAGAAGAGAGG - Exonic
1107915824 13:45149390-45149412 CAACCACAGTGGCCCAATCATGG - Intronic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1121717874 14:96089064-96089086 AAACCACAGGAGACCAAGATGGG - Exonic
1122679321 14:103445494-103445516 CAGCCAAAGAATCCCAAGAGAGG - Intronic
1122756227 14:103982499-103982521 CCACCACAGAACCCAAAGAGAGG - Intronic
1125996371 15:44165126-44165148 CAACCAAAGTCGGCCAGGAGCGG + Intronic
1127920720 15:63492221-63492243 GAACCACAGTGGCCAGAGAGAGG + Intergenic
1129772645 15:78212684-78212706 GAGCCACAGCAGCCCCAGAGAGG + Intronic
1129892702 15:79082065-79082087 CACACACAGTAGCTGAAGAGAGG - Intronic
1132792128 16:1697020-1697042 TATTCACAGTAGCCCAAGGGCGG + Intronic
1135027640 16:19010876-19010898 CAACAGCTGGAGCCCAAGAGAGG + Intronic
1135328780 16:21544478-21544500 CATCCACAGTAGCCCGGGCGCGG - Intergenic
1136228404 16:28873558-28873580 CAGCCGCAGCAGCCAAAGAGAGG + Exonic
1136339130 16:29630452-29630474 CATCCACAGTAGCCCGGGCGCGG - Intergenic
1140544610 16:75794838-75794860 CATTCACAGTAGCCAAAAAGTGG - Intergenic
1142041800 16:87899023-87899045 CATCCACAGTAGCCCAGGTATGG - Intronic
1145999786 17:29124361-29124383 CAGCCACTGGAGCCCAAGGGGGG - Intronic
1149363800 17:55920611-55920633 CAGCCCCAGTAACACAAGAGTGG - Intergenic
1150600261 17:66645120-66645142 CAATCACAGAAGCCCAAGCTGGG + Intronic
1155067793 18:22283179-22283201 CAACCCCAGTGGCTCAAAAGAGG - Intergenic
1158877583 18:61748125-61748147 CAAGCCAAGGAGCCCAAGAGGGG - Intergenic
1160424588 18:78771334-78771356 TAACAGCTGTAGCCCAAGAGTGG + Intergenic
1161081893 19:2315277-2315299 TAACCACATTAGCATAAGAGAGG - Intronic
1161532661 19:4799515-4799537 CAATCCTAGTAGCCCAGGAGTGG + Exonic
1163534862 19:17871424-17871446 CACCCAGCTTAGCCCAAGAGCGG + Intergenic
1165419144 19:35714434-35714456 CAAATAAAGTAACCCAAGAGAGG - Intronic
928091816 2:28379157-28379179 CAGCCACAGGAAACCAAGAGAGG - Intergenic
931159562 2:59673814-59673836 CAACAACAATAGCACAGGAGGGG - Intergenic
931235673 2:60410703-60410725 CAGCCACAGGACCCCAGGAGGGG + Intergenic
932440893 2:71734195-71734217 CAAACACTGGAGCCCAAGAGTGG - Intergenic
942496300 2:176543213-176543235 CAATCACTGTGGCCAAAGAGAGG + Intergenic
943485719 2:188477587-188477609 AAACCACATTAGCAAAAGAGAGG + Intronic
943644932 2:190400301-190400323 CCACCTCAGTCTCCCAAGAGTGG - Intergenic
944108373 2:196103917-196103939 CAACCACATTTGACCATGAGTGG - Intergenic
944507182 2:200424811-200424833 CAGCAACAGGAGCTCAAGAGAGG - Intronic
944969158 2:204971804-204971826 AAACAACAGTAGCAAAAGAGTGG - Intronic
945022229 2:205585309-205585331 CAACCTGAGTAGCCTTAGAGTGG + Intronic
945822019 2:214675747-214675769 CAACCACAGTAGCACAGGAAAGG + Intergenic
1168851887 20:982704-982726 CAACCAAAGTAGGCTCAGAGAGG - Intronic
1170057238 20:12219861-12219883 CAACTCCAGTAACCCAAGAGTGG + Intergenic
1175050877 20:56154321-56154343 CAACCAGACCAGCCAAAGAGGGG + Intergenic
1175701372 20:61140032-61140054 CAACCACAGCAGCTCTGGAGGGG - Intergenic
1177403767 21:20639695-20639717 CATTCACAATAGCCCAAAAGTGG + Intergenic
1179178205 21:39023629-39023651 GACCCACAGAAGCCCATGAGAGG + Intergenic
1181318634 22:21987790-21987812 AAGCCACAGGAGCCCAAGACAGG + Intergenic
1181528928 22:23504997-23505019 CAGCCACAGTTGCCCCAGAATGG - Intergenic
1183540133 22:38425008-38425030 CACCCACAGGACCCTAAGAGAGG + Intergenic
952978423 3:38715682-38715704 CAACCACCCCACCCCAAGAGTGG + Intronic
957883610 3:86254595-86254617 CACACACAGTGGCCTAAGAGAGG - Intergenic
958941846 3:100325482-100325504 CAATCACAAGAGCCCATGAGAGG - Intergenic
962937167 3:140091673-140091695 GAACCACAGAAGGCCCAGAGTGG - Intronic
966823402 3:183943001-183943023 CAACCATAGTAGCCACACAGAGG + Intronic
967197429 3:187040827-187040849 CAACTTCAGCAGCCCAAGATAGG + Intronic
972014140 4:34223059-34223081 TAACCTCAGTCTCCCAAGAGAGG - Intergenic
974582028 4:63815189-63815211 CATGCACAGTAGCCCATGCGAGG + Intergenic
975389961 4:73804357-73804379 GAACCTCATTAGGCCAAGAGTGG + Intergenic
976951233 4:90833921-90833943 CAAACAGAGTAGACAAAGAGAGG - Intronic
982123768 4:152166765-152166787 CAAGGACAGTAGCCCACGTGCGG + Intergenic
991510334 5:67369513-67369535 CAACAATAGTAGCCCAATAATGG - Intergenic
996071681 5:119138111-119138133 CAATTACAGTAGTCCAGGAGAGG + Intronic
997677709 5:135725638-135725660 CCAACACAGGAGCCCACGAGAGG - Intergenic
1002431021 5:179203915-179203937 TATTCACAGTAGCCCATGAGGGG + Intronic
1004906088 6:20238565-20238587 CAACCCCCGGAGCCCCAGAGGGG + Intergenic
1007893958 6:45328344-45328366 CAACCACAGAACCACAAGTGCGG + Intronic
1013819674 6:114139282-114139304 CAACCACAGTAGCCCAAGAGTGG - Intronic
1018953753 6:168394623-168394645 CAACCACTGAAGCCAGAGAGAGG + Intergenic
1021617978 7:22522053-22522075 GAAACACAGAGGCCCAAGAGTGG + Intronic
1022764334 7:33393794-33393816 CACCCACAATAGGCCAAGAGAGG - Intronic
1022927567 7:35071533-35071555 GAAACACAGAGGCCCAAGAGTGG + Intergenic
1025872244 7:65445893-65445915 TATCCACAGTAGCCAAAAAGTGG - Intergenic
1028374705 7:90134055-90134077 GAAACACAGAGGCCCAAGAGTGG - Intergenic
1029612473 7:101634480-101634502 CGCCCACAGAAGCTCAAGAGAGG + Intergenic
1035033746 7:155881870-155881892 GAGCGACAGTAGCCCTAGAGAGG - Intergenic
1036208531 8:6823524-6823546 CAACCACAAAAACCCAAAAGTGG + Exonic
1039621688 8:39002923-39002945 GAACCACTTTAGCCCAGGAGGGG - Intronic
1040763191 8:50874896-50874918 AAACCACAGCAGCCCTACAGAGG + Intergenic
1043564709 8:81535102-81535124 CAAGCACAGTAGCCCATCATTGG + Intergenic
1044139250 8:88629176-88629198 TAACAACAATAGCACAAGAGTGG - Intergenic
1045124164 8:99071565-99071587 CAACAACAGTAGCCACACAGTGG - Intronic
1047728585 8:127706309-127706331 CAAATATAGTAACCCAAGAGAGG - Intergenic
1049042286 8:140121555-140121577 CAGCAACAGAAGCCCCAGAGAGG + Intronic
1049402451 8:142434575-142434597 CTGCCTCAGTAGCCCAAGGGAGG - Intergenic
1049630807 8:143655594-143655616 CAACTACAGTTGGCCAGGAGTGG - Exonic
1055566201 9:77570662-77570684 TATCCATAGTAGCCAAAGAGTGG - Intronic
1055922784 9:81479131-81479153 CATCCACAATAGCCAAAGGGTGG + Intergenic
1056488715 9:87084509-87084531 CAAGCCCAGTAGGCCCAGAGTGG - Intergenic
1056671049 9:88627135-88627157 CAATCTCAGAAGCCCAAGTGTGG + Intergenic
1057350531 9:94293333-94293355 CAACCACATGAGCCCAAGAATGG - Intronic
1060475190 9:123981476-123981498 TATTCACAGTAGCCCAAAAGTGG + Intergenic
1062673664 9:137726543-137726565 CAACCACAGCAGCCAAAAGGGGG - Intronic
1062675145 9:137738610-137738632 CAACCACAGCAGCCAAAAGGGGG + Intronic
1189169111 X:38891928-38891950 CAACCACTTTAGCCCAACACAGG + Intergenic
1189651244 X:43191958-43191980 CAAACCCAGTAGCCCAAGAGTGG + Intergenic
1190580448 X:51888683-51888705 CATTCACAGTAGCCCAAAACTGG + Intronic
1192225725 X:69226696-69226718 CAGCCTCAGGAGCACAAGAGGGG - Intergenic
1194434030 X:93848546-93848568 CAACCACAGGAATCCAAGACAGG - Intergenic
1195756627 X:108205242-108205264 GAACCACAATAGCCCATGTGTGG + Intronic
1196188061 X:112765416-112765438 CAACCACAATAGCTCAATACAGG + Intergenic
1196731799 X:118948403-118948425 CAAGCACAGGAGCCCAGAAGAGG - Intergenic
1199873059 X:151914493-151914515 CAACCTCAGGACCCTAAGAGAGG + Intronic
1199873586 X:151916537-151916559 CAACCTCAGGACCCTAAGAGAGG + Intronic
1199874290 X:151919254-151919276 CAACCTCAGGACCCTAAGAGAGG + Intronic
1199981572 X:152923450-152923472 CAACCAGAGAAGATCAAGAGAGG - Intronic
1200364980 X:155652649-155652671 TATTCACAGTAGCCCAACAGTGG - Intronic