ID: 1013825376

View in Genome Browser
Species Human (GRCh38)
Location 6:114204910-114204932
Sequence TGATAAGTACACAACATGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013825370_1013825376 28 Left 1013825370 6:114204859-114204881 CCCGAGAATACTATTGGCACAAA 0: 1
1: 0
2: 1
3: 9
4: 121
Right 1013825376 6:114204910-114204932 TGATAAGTACACAACATGCCTGG No data
1013825374_1013825376 -5 Left 1013825374 6:114204892-114204914 CCAAATTCTACCAGCTCTTGATA 0: 1
1: 0
2: 1
3: 13
4: 211
Right 1013825376 6:114204910-114204932 TGATAAGTACACAACATGCCTGG No data
1013825371_1013825376 27 Left 1013825371 6:114204860-114204882 CCGAGAATACTATTGGCACAAAT 0: 1
1: 0
2: 2
3: 9
4: 256
Right 1013825376 6:114204910-114204932 TGATAAGTACACAACATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013825376 Original CRISPR TGATAAGTACACAACATGCC TGG Intronic
No off target data available for this crispr