ID: 1013831253

View in Genome Browser
Species Human (GRCh38)
Location 6:114275330-114275352
Sequence GGGACAATGTTAGCTACTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 66}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013831253 Original CRISPR GGGACAATGTTAGCTACTAC TGG (reversed) Intronic
901905636 1:12407148-12407170 GGGACAATGTTTAAAACTACAGG - Intronic
909760553 1:79280761-79280783 AGGCCAATGTTACCTACTTCAGG + Intergenic
912605452 1:110984545-110984567 TGGAGAATGTTAGCCACTTCTGG - Intergenic
916680590 1:167101355-167101377 GGGACAATCTTATATACTGCTGG + Intronic
921016006 1:211191553-211191575 GGGATAAGGTTAACTACTAAGGG - Intergenic
923044700 1:230347197-230347219 GGGAGAATCCTGGCTACTACAGG - Intronic
1063336453 10:5219945-5219967 GGGACAATGTTATGGGCTACTGG + Intergenic
1068916406 10:62436768-62436790 GGCACAATGTTACCAGCTACAGG - Intronic
1070948227 10:80410348-80410370 GAGGCAGTGTTAGCTGCTACAGG + Intronic
1072859742 10:98990763-98990785 GAGACATTGTTAGCTTCTATGGG + Intronic
1073155895 10:101346608-101346630 GGGACAATGGGAGCTGCTACTGG - Intergenic
1081360626 11:42172943-42172965 GGCACAATTTTAGATACTAGAGG + Intergenic
1081646932 11:44796600-44796622 GGGAGAATGTTGGTGACTACAGG + Intronic
1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG + Intronic
1100721415 12:97362749-97362771 GGGACACTGTTAGCTTCTAGAGG + Intergenic
1109620682 13:64900918-64900940 GGGACAATCTAATCTAATACAGG - Intergenic
1109677081 13:65691346-65691368 TGGAAAATGTAAGCTACTATAGG - Intergenic
1117571415 14:57052594-57052616 GGCACAATCATAGCTACTTCTGG + Intergenic
1120746235 14:88154461-88154483 GGGAAAATGGGGGCTACTACTGG + Intergenic
1127143080 15:55996621-55996643 GGGACTATGTATTCTACTACTGG - Intergenic
1130096510 15:80860246-80860268 TGGAAAATGTTAGCTGCTATTGG - Intronic
1131670666 15:94616347-94616369 GGGACAATGACACTTACTACAGG - Intergenic
1134018850 16:10907691-10907713 GGGTCAATGCTAGGTACTGCGGG - Exonic
1135107838 16:19666245-19666267 GGGACAATATTCTTTACTACTGG + Intronic
1139151243 16:64384540-64384562 GAGAGAATGTTAGCTACATCTGG - Intergenic
1143530297 17:7499061-7499083 GGGACATTGTTATCTTCAACCGG + Exonic
1153814047 18:8777760-8777782 GGGACGATGTTTGCTAATGCTGG + Intronic
1155554715 18:27005902-27005924 GAAACAAAGTTAGGTACTACTGG + Intronic
1156398371 18:36718901-36718923 GTGACCATGTTAGCTAATAAGGG - Intronic
1161281358 19:3447503-3447525 GGAAGAATGTTAGCTACTGCAGG - Intronic
926613839 2:14975020-14975042 GGGTCATTCTTAGCTACTAGGGG - Intergenic
927832843 2:26368843-26368865 GGGAATATTTTAGCTACTTCAGG + Intronic
930723062 2:54656516-54656538 GGGAATATGTGAGCTAATACAGG + Intronic
931721459 2:65070252-65070274 GGGACAGTGCTGCCTACTACAGG - Intronic
938420334 2:131140822-131140844 GGGACAATGCTGGCCACTGCTGG + Intronic
945197394 2:207250122-207250144 GGGACAATGTTAGCCACTGTGGG + Intergenic
945432692 2:209782581-209782603 GATACTATGTTAGCTACCACGGG - Intronic
946773484 2:223113102-223113124 GGGACACTGTCAGCTCCTAGGGG + Intronic
1173034614 20:39396511-39396533 GAGATAATGTTATATACTACTGG - Intergenic
949247435 3:1941973-1941995 GGTAGAATGTTAACTACTAAAGG - Intergenic
951142055 3:19174129-19174151 GGGAAAATGTTACCTGCCACAGG - Intronic
954087420 3:48256371-48256393 GGGACAATGTCTGCTACTCAAGG - Intronic
955470154 3:59278408-59278430 GGGAGACTGTTGGCTACTGCAGG - Intergenic
964741940 3:159975425-159975447 GAGACAGTGTTAGATCCTACAGG - Intergenic
970003831 4:11391610-11391632 GGGACACTCTCAGCTACTACTGG + Intergenic
971139615 4:23909885-23909907 GGTCCAATGTTAGCTGCTAAGGG + Intergenic
972327721 4:38033448-38033470 GGGACAGTGAAAGCTAATACGGG - Intronic
974117217 4:57593861-57593883 GGGTCAAGGTTAAATACTACTGG - Intergenic
979791718 4:124791489-124791511 GGGATAATGTAAGCTAATATAGG + Intergenic
980701120 4:136432278-136432300 AAGACAACGTTAGTTACTACAGG + Intergenic
982115967 4:152098694-152098716 AGGAGGATGTTTGCTACTACAGG + Intergenic
987508768 5:18807988-18808010 GAGACAGTGTTAACTATTACTGG - Intergenic
990673210 5:58155814-58155836 GGAATTATGTTAGCTACTGCTGG - Intergenic
991643890 5:68781289-68781311 AGGGCAATGTTACCTATTACTGG - Intergenic
993324880 5:86521611-86521633 GGTACAATGTTTGCTATTATGGG + Intergenic
1000870409 5:166570134-166570156 GTCACACTGTTAGCTACTAGGGG + Intergenic
1001376360 5:171262885-171262907 AGGAAAATGGTAGCTAATACAGG - Intronic
1005702426 6:28415342-28415364 AGTACAATGTAAGCTGCTACAGG - Intergenic
1010406985 6:75516828-75516850 GGGACAGTTTTTGCTGCTACTGG - Intergenic
1013831253 6:114275330-114275352 GGGACAATGTTAGCTACTACTGG - Intronic
1021774906 7:24043993-24044015 GGGACAAAGATGTCTACTACAGG + Intergenic
1024099119 7:46011068-46011090 TGGACAATGTCAGCTTCTGCTGG + Intergenic
1028404372 7:90460264-90460286 GAGACAATGTCAGATCCTACAGG + Intronic
1036009757 8:4708894-4708916 GTGACAATGTGAGCAAATACAGG + Intronic
1045616553 8:103920288-103920310 GGGACAATGATAGCTCCTTTTGG - Intronic
1051122369 9:13765254-13765276 GGGAAAAAGATAGCTATTACAGG + Intergenic
1060577494 9:124709967-124709989 GGGACATTGTTAGAAAGTACTGG - Intronic
1186635136 X:11395613-11395635 GGGAAAACATTAGGTACTACCGG + Intronic
1187276519 X:17820731-17820753 GGGAAAATGACACCTACTACTGG + Intronic
1190337533 X:49271186-49271208 GGGACAAAGTTAGCTGCTGAAGG + Intronic
1193933961 X:87592024-87592046 AGGAGAATGATGGCTACTACGGG - Intronic
1197109277 X:122754162-122754184 GAGACACTGTTGACTACTACAGG - Intergenic