ID: 1013833067

View in Genome Browser
Species Human (GRCh38)
Location 6:114297707-114297729
Sequence ATCAGACTGTTGCTCCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013833067 Original CRISPR ATCAGACTGTTGCTCCTTGA AGG (reversed) Intronic
901332991 1:8424664-8424686 GGCAGACTGCAGCTCCTTGAGGG - Intronic
901948241 1:12720973-12720995 ATCAGAGCCTTGCTCCTTGCTGG - Intronic
902554666 1:17239932-17239954 ATCAGACTGTGGGTTCCTGAAGG - Intronic
906102312 1:43271458-43271480 TGCAGACTGGGGCTCCTTGAAGG + Intronic
907526649 1:55057643-55057665 ATCAGACTGAGTGTCCTTGAAGG - Intronic
908390390 1:63678476-63678498 ACCAGACTGAGGCTCCTTAAGGG - Intergenic
913442380 1:118911570-118911592 ATTAGACTGTTGCATCTTGAAGG - Intronic
913682791 1:121202785-121202807 AATAGACTGCAGCTCCTTGAAGG - Intronic
914034633 1:143990410-143990432 AATAGACTGCAGCTCCTTGAAGG - Intergenic
914154819 1:145077558-145077580 AATAGACTGCAGCTCCTTGAAGG + Intronic
915845183 1:159255584-159255606 ATCAGAGTGGTGGTCCCTGAAGG + Intergenic
916636463 1:166674714-166674736 ATCACACAGTTGCACCTTGTAGG + Intergenic
917231930 1:172846744-172846766 ATGAGGCTGAAGCTCCTTGAGGG - Intergenic
918215275 1:182388049-182388071 ATCTAACTGTAGCTCCTAGAGGG + Intronic
918815284 1:189172959-189172981 ATCAGTCTGTTGCTCCACAATGG + Intergenic
920286196 1:204881607-204881629 ATCAGACTGAAGCTCATTGACGG - Intronic
920470103 1:206221298-206221320 AATAGACTGCAGCTCCTTGAAGG - Intronic
920563172 1:206953607-206953629 TTCAGACTGTGGCTTCTTTAGGG - Intergenic
923269838 1:232345768-232345790 ATAAGAATATTGCTCTTTGATGG + Intergenic
1068172389 10:53412021-53412043 GTGAGACTGTTGCCCATTGAGGG + Intergenic
1072692759 10:97582655-97582677 ATCAAACTGCTGCTCCTGCATGG + Exonic
1075325955 10:121532381-121532403 ATCACACTGTGGCTTCTGGATGG - Intronic
1078107658 11:8368702-8368724 ACCAGACTGGGGCTCCTTGAGGG - Intergenic
1079144910 11:17842108-17842130 ATAAGACTTAAGCTCCTTGAGGG + Intronic
1080949243 11:37009762-37009784 ATCAGTATGTAGCCCCTTGAGGG - Intergenic
1088612254 11:111589215-111589237 TTCAGGCTGCTTCTCCTTGAGGG - Intergenic
1089578853 11:119468889-119468911 TCTAGACTGTGGCTCCTTGATGG - Intergenic
1093800192 12:23363395-23363417 ATCAGAATATTGCTCCTTTGAGG - Intergenic
1095280376 12:40345077-40345099 TTCAGTCATTTGCTCCTTGAAGG + Intronic
1097712338 12:62930706-62930728 GTCAGACTGTTGCTCCCCAAGGG + Intronic
1098112938 12:67143132-67143154 ATGAGAATGTTACTTCTTGAAGG - Intergenic
1099024221 12:77445385-77445407 CCCATACTGTGGCTCCTTGAAGG - Intergenic
1100358800 12:93857399-93857421 ATCAGCCTGTTGCTAATTCAAGG + Intronic
1102957882 12:117071338-117071360 AGCAGACTGTGGCTTCTTGGAGG - Intronic
1103059874 12:117849972-117849994 ATCATACTCTTACTTCTTGAGGG - Intronic
1116287755 14:42994255-42994277 ATAAGACTATTGCTTCTGGATGG - Intergenic
1124366232 15:29073155-29073177 ATCAGTGTCTTGCTCTTTGATGG - Intronic
1125069350 15:35533204-35533226 ATCAGGCTGTTGCTGGTAGAAGG - Intronic
1126444530 15:48727465-48727487 AGCAGACTTTAGGTCCTTGATGG + Intronic
1126578705 15:50222376-50222398 ATCCAACTGTTGCTCTTTAATGG + Intronic
1126878459 15:53069508-53069530 ATCAGAATGTGTCTCCTTGATGG + Intergenic
1127771139 15:62231789-62231811 TTCAGACTCTTGATCTTTGAGGG + Intergenic
1133626955 16:7579520-7579542 ATGAGAATGATGCTCCCTGAGGG + Intronic
1137028053 16:35498213-35498235 ATCAGTCTGTTGGTCATTCAGGG + Intergenic
1137621207 16:49877548-49877570 CTCAGACTGTGTCTCCCTGAGGG + Intergenic
1141039636 16:80661825-80661847 ACCAGACTGTGGCCTCTTGAGGG + Intronic
1141507271 16:84486158-84486180 ATCAGAGTATTCTTCCTTGAGGG + Intronic
1144232160 17:13218521-13218543 ATAAGATTGTTGCTCCTTTTGGG + Intergenic
1146029215 17:29350356-29350378 AGCGCACTGTTACTCCTTGAGGG + Intergenic
1146799510 17:35807447-35807469 ATGAGACTGTAGTTCCTGGAAGG + Intronic
1147934130 17:44001791-44001813 CTCAGACTGGGGCTCCCTGAGGG - Intronic
1148342361 17:46880950-46880972 ATTAGACTGTAGGTCCCTGAAGG - Intronic
1150536080 17:66042471-66042493 ATCAGACAGTTTCTACTAGATGG + Intronic
1203172255 17_GL000205v2_random:158885-158907 ATCAAACAGTTGCTGGTTGAAGG - Intergenic
1203173462 17_GL000205v2_random:173865-173887 ATCAAACAGTTGCTGGTTGAAGG + Intergenic
1158624852 18:59062205-59062227 ACCAGATTAATGCTCCTTGATGG - Intergenic
1158700796 18:59744191-59744213 TTCAGACTATTGCTTCTTGATGG - Intergenic
1161537585 19:4829694-4829716 ATCAAGCTCTTGCTCCTTGCTGG - Intronic
1164019000 19:21280475-21280497 ATCAAGCTGTTGCTGTTTGATGG - Intronic
925013122 2:500897-500919 ATAAGATTGTAACTCCTTGAGGG - Intergenic
927637765 2:24828515-24828537 ATCACACTGTTGCTTCAGGAGGG + Intronic
929575089 2:43046442-43046464 ATCAGCCTGTTTCTCTTGGATGG + Intergenic
932132596 2:69201330-69201352 GTGAGACTGTGGCTCCTTCAGGG + Intronic
934650225 2:96086279-96086301 ACCAGACTGTGGCTCCTCAAGGG - Intergenic
934651930 2:96097786-96097808 ATCAGAATGGTGCTCCTTCTGGG + Intergenic
934772101 2:96913645-96913667 ATCAGTCAGTTCCTCCTTGGTGG + Intronic
942144793 2:173016392-173016414 CTCTGGCAGTTGCTCCTTGAGGG - Exonic
943442187 2:187938924-187938946 ATTAGACAGTGGTTCCTTGAGGG + Intergenic
945846301 2:214949055-214949077 ATCAGAATGTTTCCACTTGAAGG + Exonic
945852211 2:215022403-215022425 ACCATAATGTTGCTCCTTGGTGG - Intronic
1169237275 20:3941004-3941026 ATAAGGCTGTTCCTCCGTGAAGG + Intronic
1172625165 20:36342583-36342605 CTCAGACAGTTGCTCCCTGCGGG - Intronic
1175323371 20:58105417-58105439 AGAAGATTGTTGCTTCTTGAGGG - Intergenic
1176328242 21:5520724-5520746 ATCAAACAGTTGCTGGTTGAAGG - Intergenic
1176329449 21:5535507-5535529 ATCAAACAGTTGCTGGTTGAAGG + Intergenic
1176398308 21:6285444-6285466 ATCAAACAGTTGCTGGTTGAAGG - Intergenic
1176399515 21:6300227-6300249 ATCAAACAGTTGCTGGTTGAAGG + Intergenic
1176437642 21:6688877-6688899 ATCAAACAGTTGCTGGTTGAAGG - Intergenic
1176438849 21:6703660-6703682 ATCAAACAGTTGCTGGTTGAAGG + Intergenic
1176461904 21:7015947-7015969 ATCAAACAGTTGCTGGTTGAAGG - Intergenic
1176463111 21:7030729-7030751 ATCAAACAGTTGCTGGTTGAAGG + Intergenic
1176485465 21:7397725-7397747 ATCAAACAGTTGCTGGTTGAAGG - Intergenic
1176486672 21:7412508-7412530 ATCAAACAGTTGCTGGTTGAAGG + Intergenic
1177918017 21:27114979-27115001 AACAGACTGTTTTTCTTTGAAGG + Intergenic
1181421729 22:22804088-22804110 ACCAGACTGTTGCTATTAGAAGG + Intronic
1182124529 22:27806863-27806885 AGCAGACTATAGCTCCATGAGGG - Intergenic
1184898586 22:47427826-47427848 ATCTGACTTTTGCTCCCTGATGG - Intergenic
955091275 3:55753144-55753166 ATCACATGGTTGCTCCTGGATGG + Intronic
955604266 3:60683388-60683410 ATCAGACTGGTGGTTGTTGAGGG - Intronic
956403092 3:68900632-68900654 ATCAAACTGGAGCTCCGTGAGGG + Intronic
960532965 3:118786098-118786120 ATTAGACTGTGAATCCTTGAGGG - Intergenic
962261196 3:133908751-133908773 GTCTAACTGTTGCTCCTTTAAGG + Intergenic
963811389 3:149780243-149780265 ATCAGTCTGGTAGTCCTTGAGGG + Exonic
963932278 3:151015759-151015781 ATGAGACTATTGACCCTTGAGGG + Intergenic
965918114 3:173876094-173876116 ATCAAACTGATTCTCCTGGAAGG + Intronic
966081272 3:176004783-176004805 ATGAAATTGTTGTTCCTTGAAGG - Intergenic
970340514 4:15101556-15101578 ATCACTCTGTTTCTCCTCGATGG - Intergenic
976222525 4:82769139-82769161 ATTAGACTGGTTCTCCTTGAAGG + Intronic
1000838896 5:166191096-166191118 AAAAGATTGTTGCTCCTGGAAGG + Intergenic
1005963685 6:30711596-30711618 ATTAGACTGGTGGTCCTTGAAGG - Intronic
1005968138 6:30742031-30742053 ACCAGACTTCTGCCCCTTGATGG - Intronic
1007210763 6:40191967-40191989 CTCAGACTGGGGCTCCCTGAGGG - Intergenic
1007231432 6:40349966-40349988 CTCTGACTGCTGCTCCTTGTGGG - Intergenic
1007740108 6:44004850-44004872 CTCAGACTGGAGCTCCCTGAGGG + Exonic
1007832011 6:44646065-44646087 AAAAGACAGTTGCTCCTTGAGGG + Intergenic
1013164845 6:107580503-107580525 ACCAGACTGAAACTCCTTGACGG - Intronic
1013833067 6:114297707-114297729 ATCAGACTGTTGCTCCTTGAAGG - Intronic
1014977838 6:127911267-127911289 CTTACACTGTAGCTCCTTGAGGG + Intronic
1015022575 6:128493941-128493963 AACAGACTGAAGCTCCTAGAGGG + Intronic
1016330335 6:142946895-142946917 ATCAGACTGTGGCTCCCGGCTGG + Intergenic
1017450974 6:154554000-154554022 ATCAAAGTGGAGCTCCTTGATGG + Intergenic
1017952009 6:159142987-159143009 ATCAGACCATTGTTCCTTAAGGG + Intergenic
1020247283 7:6439710-6439732 ATCCCACTGTTGCACCTTGTGGG - Intronic
1021699155 7:23300743-23300765 AGCTGACTGTTCCTCCATGAGGG - Intronic
1024902980 7:54343444-54343466 ATCAGACTGTAGCCTCTTAAGGG - Intergenic
1026183716 7:68064494-68064516 GTCAGGCTCTTGCTCTTTGATGG - Intergenic
1030278004 7:107740497-107740519 AACAGAATGTTGCTGATTGAAGG - Intergenic
1032324089 7:130910255-130910277 ACCAGACTGTTACTACTTAAAGG + Intergenic
1034507996 7:151510566-151510588 ACTAGACTGAAGCTCCTTGAGGG + Intronic
1036112868 8:5924039-5924061 ATCTAACTGTTGCCCCTTTAAGG - Intergenic
1038261625 8:26001167-26001189 GTCAGAATGGTGCTCTTTGAGGG - Intronic
1039451049 8:37675368-37675390 ATCTGGCTGTTCCTTCTTGACGG - Intergenic
1047138341 8:122106985-122107007 TTCAGACTTTGGCTCCTGGATGG - Intergenic
1050863714 9:10470421-10470443 ATCAGACTGTTTTTCTTAGAAGG - Intronic
1052565269 9:30141621-30141643 ATCATACTATAGCTCCCTGATGG - Intergenic
1056062312 9:82896495-82896517 ATCAGCCTGTTGCTCCCTGAGGG - Intergenic
1060376960 9:123124286-123124308 ACCACACTGCTGCTCCTTCATGG + Exonic
1062217000 9:135394613-135394635 AGCAGACTGTGGCTCTGTGAGGG + Intergenic
1203432646 Un_GL000195v1:104819-104841 ATCAAACAGTTGCTGGTTGAAGG - Intergenic
1203433862 Un_GL000195v1:119745-119767 ATCAAACAGTTGCTGGTTGAAGG + Intergenic
1186831586 X:13395792-13395814 ATCAGACTGTTACTGGTGGAGGG + Intergenic
1187497544 X:19808444-19808466 ATAAGCCTTTTGCTCCTTAAAGG + Intronic
1193480435 X:82020696-82020718 ATTGGACTGTTGCTCCATAATGG + Intergenic
1193803439 X:85965431-85965453 ATCAGACTGTAATTCCTTGAGGG + Intronic
1194908157 X:99604977-99604999 ATCAGACCCTTGCAGCTTGAGGG - Intergenic
1196290050 X:113929568-113929590 TTCAGACCTTTGCTCCTTAATGG - Intergenic