ID: 1013835046

View in Genome Browser
Species Human (GRCh38)
Location 6:114324764-114324786
Sequence AGGTGCATTCAGATGGACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013835041_1013835046 27 Left 1013835041 6:114324714-114324736 CCATCACTGTATAGTGGTGTTCT 0: 1
1: 0
2: 0
3: 10
4: 101
Right 1013835046 6:114324764-114324786 AGGTGCATTCAGATGGACCAGGG 0: 1
1: 0
2: 1
3: 15
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013835046 Original CRISPR AGGTGCATTCAGATGGACCA GGG Intronic
901572467 1:10172742-10172764 AGGTGCTTTCTGATGTAGCAGGG + Intronic
901838388 1:11938657-11938679 AGGTGGATTCAGCTGGAGTAGGG + Intronic
902228781 1:15014127-15014149 AGACTCATTCAGAAGGACCAAGG - Intronic
907313422 1:53552727-53552749 AGGAGGATCCAGCTGGACCACGG + Intronic
907837400 1:58123355-58123377 AGATGCTTTCAGATGGAGTAAGG - Intronic
908659324 1:66420593-66420615 AGGGGCCTTAAGATAGACCAAGG + Intergenic
911820243 1:102410128-102410150 AGCTGCATTTAGATGAACTATGG + Intergenic
916677172 1:167073733-167073755 GGGTGGAGTCAGGTGGACCAAGG - Intronic
917086602 1:171310621-171310643 AGGGGCCTTATGATGGACCAAGG - Intergenic
917280387 1:173373657-173373679 AGGGGCCTTATGATGGACCAAGG - Intergenic
918874570 1:190023423-190023445 AGGTGCATTCATTTGATCCAAGG - Intergenic
920029668 1:203028946-203028968 TGGAGGATTCAGAGGGACCATGG + Intronic
920101358 1:203518898-203518920 TAGTGCATGCAGATGGACCTGGG + Intergenic
921805407 1:219448568-219448590 AGGTGTAGACAGATGGACAATGG - Intergenic
924596213 1:245447181-245447203 ATGTTAATTCAGATGGGCCACGG - Intronic
1063565734 10:7171258-7171280 ATGTGCCTTCAGATGGAAGAAGG + Intronic
1065599955 10:27358179-27358201 AGGTGCAGTAAGATGGCGCAGGG + Intergenic
1066040229 10:31541948-31541970 AAGTCCATTCAGATGGTCAAGGG - Intergenic
1067094068 10:43286779-43286801 AGGTGCATTCAGGTGTCACAGGG - Intergenic
1067427450 10:46220690-46220712 AGCTGCATTCTGAGGAACCAGGG - Intergenic
1068500804 10:57838471-57838493 AGGGGCCTTATGATGGACCAAGG - Intergenic
1069121819 10:64577053-64577075 AAGTGCATGCTGATGGTCCATGG - Intergenic
1070117916 10:73547024-73547046 ATGTGCATTCAAATACACCAAGG - Intronic
1070255927 10:74813316-74813338 GGGTGCACTCAGATGGAGAAAGG + Intergenic
1071948284 10:90673036-90673058 TTGTGCCTTCATATGGACCAGGG - Intergenic
1075408091 10:122207914-122207936 AGGTGCTTTCAAATGGGCCTTGG - Intronic
1076983914 11:222139-222161 AGGAGCAGTCAGAGGGGCCATGG - Intronic
1078722597 11:13898140-13898162 TGGTGCCTTCAGATGGACCCCGG + Intergenic
1085058901 11:73426487-73426509 AGGTGCCTTCAGAAGGAACCAGG - Intronic
1086054046 11:82627126-82627148 AGGGGCCTTATGATGGACCAAGG - Intergenic
1087908361 11:103725148-103725170 AGGTGAATTCAGATGGAGATGGG - Intergenic
1092061872 12:5557688-5557710 AGGTGTAGTCAGGTGAACCAAGG + Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1093094466 12:14957114-14957136 AGATTGAGTCAGATGGACCAGGG + Intronic
1094686691 12:32723744-32723766 AGCTGCATTTAGATGAACTACGG + Intronic
1096266821 12:50130109-50130131 TGCTCCATTCAGATGGTCCAGGG + Exonic
1099376749 12:81902207-81902229 AGGGGCCTTATGATGGACCAAGG - Intergenic
1101420546 12:104547241-104547263 AGTTGCAGGCAGATGGGCCAAGG + Intronic
1103159051 12:118712434-118712456 ACATGGATTCAGATGGACCTGGG + Intergenic
1104536049 12:129619232-129619254 AGGTCCATTCAGATGGTCGAGGG + Intronic
1105589910 13:21782620-21782642 ATTTGCATTCAGGTGGAGCATGG + Intergenic
1105626857 13:22121126-22121148 ATGTGCATTAAGAGGTACCATGG - Intergenic
1107958830 13:45541868-45541890 TGTTGCAGTCAGGTGGACCATGG + Intronic
1108798511 13:54064224-54064246 AGGAGGATTTAAATGGACCAAGG - Intergenic
1110287987 13:73772424-73772446 AGCTTAATTCAGATGCACCATGG - Intronic
1113413114 13:110107630-110107652 CGGAGCCTTCAGAGGGACCACGG + Intergenic
1114775531 14:25476422-25476444 AGGCACATTCAGCTGGAACAGGG + Intergenic
1115338193 14:32263229-32263251 AGGTGTATGCAGAAAGACCAGGG - Intergenic
1117575357 14:57092067-57092089 AGGGGCATTCAAATGGACAGTGG + Intergenic
1118858992 14:69647160-69647182 AGGAGCATTCAGCTTCACCAAGG - Intronic
1120258377 14:82149782-82149804 TGTTGCATTCAGATGGATCTAGG + Intergenic
1121666386 14:95675612-95675634 AGGTGCACTCTGATTGGCCATGG - Intergenic
1122255006 14:100470172-100470194 AGGTTCTTGCAGATGGAACAAGG + Intronic
1125827955 15:42691926-42691948 TGGTGCTCTCAGATGGACAAAGG + Exonic
1126070911 15:44864105-44864127 AGGGGCCTTATGATGGACCAAGG + Intergenic
1126351642 15:47750565-47750587 ATGTGCATTCTGAAGGAGCAAGG - Intronic
1133227379 16:4348217-4348239 ATATTCATTCAGATGCACCAGGG - Intronic
1133346781 16:5076415-5076437 AGGTGCATAGAGATTGAACAGGG - Intronic
1133894185 16:9909702-9909724 AGATGCATTTAGATGGCACATGG + Intronic
1134265954 16:12692770-12692792 AGGTGCCTTCAGTGGCACCATGG + Intronic
1135170675 16:20180620-20180642 AGGTGATTTCAGATTGACCCTGG + Intergenic
1135808450 16:25565708-25565730 AGTTGCATTCAGATGGCCTGGGG - Intergenic
1135910024 16:26551864-26551886 ATCTGCATTCAGAGGGCCCAAGG - Intergenic
1139058544 16:63219927-63219949 AGGTCCATTCAGATGGCTGAGGG - Intergenic
1144617391 17:16788995-16789017 AGGGTGATTCAGATGGACAAAGG - Intronic
1144895311 17:18526687-18526709 AGGGTGATTCAGATGGACAAAGG + Exonic
1145136910 17:20417544-20417566 AGGGTGATTCAGATGGACAAAGG - Intergenic
1145804594 17:27717488-27717510 AGGAGCCTTATGATGGACCAAGG - Intergenic
1146311003 17:31768252-31768274 AGGGGCCTTACGATGGACCAAGG - Intergenic
1146376608 17:32298800-32298822 AGATGCCTTCAGATGGAGCCAGG - Intronic
1147555295 17:41475333-41475355 ATGTGGAGTCAGATGGACCTGGG - Intergenic
1149870122 17:60173416-60173438 AGGGTGATTCAGATGGACAAAGG - Intergenic
1149982367 17:61321552-61321574 AGGGGCATCCAGATGGCCCAGGG - Intronic
1150974999 17:70075333-70075355 AGGTGCTTTCAGCTGGGCAATGG - Exonic
1155475620 18:26233869-26233891 AGGGGCCTTACGATGGACCAAGG + Intronic
1157091822 18:44645151-44645173 AGGTTCATTCACACGGACCACGG + Intergenic
1157187337 18:45551866-45551888 GGTGGCATTCAGATGGACAAAGG - Intronic
1157807496 18:50668980-50669002 AAGTGCATTCAGATGTACGCAGG + Intronic
1158978957 18:62739972-62739994 AGGTGCTTTAGGATGGCCCAAGG - Intronic
1162857827 19:13482620-13482642 CCCTGCAGTCAGATGGACCATGG + Intronic
1163112707 19:15170947-15170969 AGGTGGATGCAGGTGGGCCATGG - Intronic
1166165016 19:40981315-40981337 AGGTGGTTTCAGATGGAGAAGGG - Intergenic
1168502064 19:56901036-56901058 AGGTGGATTCAGATGCAACAGGG + Intergenic
925359615 2:3268235-3268257 AGGTGCCTTCAGAGGGAACCAGG - Intronic
926932745 2:18056702-18056724 AGCTGCATGCGGATAGACCAAGG + Intronic
929009524 2:37427271-37427293 GGGTTCATTCAGATGGATGAGGG - Intergenic
929386640 2:41415495-41415517 ATTTGTATTCAGATGGACAATGG - Intergenic
931275502 2:60740431-60740453 AGATGCATTCAGAGGTCCCAGGG - Intergenic
931906334 2:66847358-66847380 CTGTGCATTCAGTTGGTCCAAGG - Intergenic
937037210 2:118792174-118792196 AGGTTCATTCAGACCTACCATGG + Intergenic
938387017 2:130873826-130873848 GGATGAAATCAGATGGACCAGGG - Intronic
940856474 2:158732258-158732280 AGGGGCATTCAGAAGGGGCATGG - Intergenic
943623401 2:190174382-190174404 AGGGGTATTCATATGGACAAGGG - Intronic
946030893 2:216704183-216704205 TGGTGCCTTCAGAGGGAGCACGG - Intergenic
946206302 2:218111408-218111430 AGGGGCCTTACGATGGACCAAGG + Intergenic
948048855 2:234964485-234964507 AGGGGCATTCAAGTGCACCAGGG + Intronic
1169326306 20:4679447-4679469 AGGTGAACTCAGATGGGCCAAGG + Intergenic
1170409389 20:16072378-16072400 AGGTGAACTCAGATGGGTCATGG + Intergenic
1172813619 20:37669510-37669532 AGCTGCAACCAGATGTACCAAGG - Intergenic
1172815386 20:37682139-37682161 AGGTGAAATCAGTAGGACCAAGG - Intergenic
1172823081 20:37756147-37756169 AGGAGCAATCAGATGGAGCTGGG - Intronic
1173308589 20:41875303-41875325 AGGTCAACTCAGATGGGCCAAGG - Intergenic
1175090085 20:56495509-56495531 AGTAGCATCCAGGTGGACCAAGG + Intronic
1175598825 20:60256406-60256428 AGGTGCCTTCAGATGAATTAGGG + Intergenic
1176172646 20:63703020-63703042 AGGTGCACTCATCTGGTCCAGGG - Intronic
1176966870 21:15220956-15220978 AGGTACATACAGTTGGACAATGG - Intergenic
1178178052 21:30127980-30128002 AGGTGAATTCACAAGGAGCAAGG - Intergenic
1179103902 21:38381321-38381343 AGTTGCCTTCACCTGGACCAAGG + Exonic
1182693439 22:32179409-32179431 ACAGGCAATCAGATGGACCATGG - Intergenic
1183942870 22:41306040-41306062 AGAGGCATTGAGATGGACAAAGG + Intronic
954098174 3:48347706-48347728 AGGAGAACTCAGATGGGCCAAGG + Intergenic
956701334 3:71961570-71961592 AGGTGCATGCAGGTGGACCATGG + Intergenic
956705029 3:71992294-71992316 AGGTGAATTCAGGCGGCCCAAGG - Intergenic
957427702 3:80062300-80062322 TAGTGCATTCATATGGCCCAAGG - Intergenic
962309299 3:134313928-134313950 AGGTGCTTTCTGATCGGCCAGGG + Intergenic
962734965 3:138317496-138317518 AGGGGCATAGAGCTGGACCATGG + Intronic
964000091 3:151760815-151760837 TGGTGCCTTCAGAGGGACCATGG - Intronic
964086846 3:152828937-152828959 ATGTGCATTCAGATCACCCAGGG - Intergenic
964796756 3:160506535-160506557 GGGTGCATTCAGGTGGAACATGG - Intronic
965785099 3:172327234-172327256 AGGTGCATTCAGATGCAACTTGG - Intronic
968181882 3:196601440-196601462 AGGTGCTCTCAGAGGGAGCAAGG - Intergenic
969202858 4:5619506-5619528 TGGTGCCTTCAGAGGGAGCATGG + Intronic
969900443 4:10344427-10344449 AGGTGGTTTTAGATGGAACAAGG + Intergenic
975651572 4:76598645-76598667 AGGTGGATACAGCTGCACCAGGG - Intronic
975981608 4:80167003-80167025 AGGTGCATACAGATTGAAGATGG + Intergenic
975991699 4:80265395-80265417 AGGTCAATTCAGATGAACCAAGG - Intergenic
976517035 4:85980757-85980779 AGATGCATTCAGGAGGTCCATGG + Intronic
977884666 4:102241873-102241895 AGGGGACTTCAGATGAACCAAGG - Intergenic
981005040 4:139865986-139866008 AGGGGCATGCAGGTGGACCTTGG + Intronic
981067971 4:140505536-140505558 AGCTGCATTCAGTTGGAGCTTGG - Intergenic
982352701 4:154433296-154433318 TGGAGCCTTCAGAGGGACCATGG + Intronic
982984269 4:162185490-162185512 AGGTTCTGTCAGCTGGACCATGG + Intergenic
982984476 4:162188802-162188824 AGTAGCTTTCAGAAGGACCATGG - Intergenic
984939452 4:184918548-184918570 AGGGGCCTTATGATGGACCAAGG + Intergenic
986256855 5:6108066-6108088 CTGTGCATTCAGATGTGCCATGG + Intergenic
988937702 5:36105177-36105199 AGCTGCATTCAAATATACCAGGG - Exonic
989120934 5:38003949-38003971 AAGAGCATTTAGAAGGACCATGG + Intergenic
992049860 5:72932087-72932109 AGGGGCCTTATGATGGACCAAGG - Intergenic
992174803 5:74139549-74139571 TGGTGCATGCATGTGGACCACGG + Intergenic
993677981 5:90840338-90840360 AGATGCCTTCAAATGGACCAAGG - Intronic
994521507 5:100843695-100843717 ATCTTCATTCAGATGGATCATGG - Intronic
994874381 5:105397602-105397624 TCGTGCATCCAGATGGACTAAGG + Intergenic
995528075 5:113066721-113066743 AGGTGCATTCAGAAGGTGCCTGG + Intronic
995706912 5:114996171-114996193 AGGGGCCTTATGATGGACCAAGG - Intergenic
996680702 5:126225937-126225959 AGGGGCCTTACGATGGACCAAGG - Intergenic
997072790 5:130638756-130638778 AGGGGCCTTATGATGGACCAAGG - Intergenic
998713377 5:144851089-144851111 AGGGGCCTTACGATGGACCAAGG + Intergenic
1002573284 5:180156223-180156245 AGGTGCATGCTGATGGTGCAAGG + Intronic
1004299763 6:14446616-14446638 TGGTGCCTTCAGAGGGAGCATGG - Intergenic
1009385490 6:63081010-63081032 AGGGGCCTTATGATGGACCAAGG + Intergenic
1010177355 6:73044504-73044526 ACATCCATTCAGCTGGACCATGG - Intronic
1011886745 6:92106059-92106081 CTGTGAATTCATATGGACCAGGG + Intergenic
1013835046 6:114324764-114324786 AGGTGCATTCAGATGGACCAGGG + Intronic
1014202723 6:118623210-118623232 AGGGGCCTTATGATGGACCAAGG - Intronic
1015727493 6:136314471-136314493 AGGTGGATCCAGGTGGATCAAGG + Intergenic
1018973792 6:168548200-168548222 AAGGGCATTCAGAAGGTCCAGGG - Intronic
1019611419 7:1938703-1938725 AGGTGCACACACATGGGCCAGGG + Intronic
1023081987 7:36534416-36534438 AGGTGCATTTAGAAGAACCTGGG + Intronic
1024870315 7:53956920-53956942 AGGGGCCTTATGATGGACCAAGG + Intergenic
1027134365 7:75613643-75613665 AGGCGCTCTCAGATGGACCTGGG - Intronic
1027584899 7:80045445-80045467 AGGTGCTTTCAGATGGAGATGGG - Intergenic
1032144413 7:129366237-129366259 AGGTGCATTCAGACGTATCAAGG - Intronic
1036194658 8:6703682-6703704 AGATGCTTTCAGCTGGTCCAAGG - Intergenic
1037989579 8:23311305-23311327 AGGTGCACACAGATGGCACATGG + Intronic
1038430319 8:27494641-27494663 AGGGGCCTTATGATGGACCAAGG + Intronic
1038477180 8:27876614-27876636 AGGTGCACTCGGATGCCCCATGG - Intronic
1039320711 8:36427474-36427496 AGGTGCATCCAAATGCAGCAAGG + Intergenic
1041053037 8:53956097-53956119 AGGAGGCTACAGATGGACCAAGG + Intronic
1042120630 8:65484301-65484323 AGCTGAATTCCGCTGGACCACGG - Intergenic
1042352210 8:67788911-67788933 ATGTGCAGTCAGATGGACCTGGG - Intergenic
1042772376 8:72393739-72393761 AGGAGCCTTATGATGGACCAAGG - Intergenic
1042920078 8:73911776-73911798 AGGGGCCTTACGATGGACCAAGG - Intergenic
1045646213 8:104301893-104301915 AGATGCTTCCAGATGGATCAAGG + Intergenic
1046688105 8:117249599-117249621 AAGAGCTTTCAGATGGACCATGG - Intergenic
1047799844 8:128297419-128297441 AGGTGAATGAAGATGGAGCATGG - Intergenic
1047988125 8:130258061-130258083 AGGTGAGTTCAGATCAACCAGGG - Intronic
1048917713 8:139200591-139200613 AGCTGGATTCAGCTGGACAAGGG + Intergenic
1051531785 9:18112247-18112269 AGGTGAACTCAGATGGACTAAGG - Intergenic
1052738821 9:32373908-32373930 AGATGCCTGCAGATGGAGCATGG + Intergenic
1055382290 9:75721739-75721761 GCATGCCTTCAGATGGACCATGG + Intergenic
1055497320 9:76868476-76868498 AGGTGCATACGGGAGGACCACGG + Intronic
1056392308 9:86151509-86151531 AGGAGCCTTATGATGGACCAAGG + Intergenic
1056713587 9:89010604-89010626 AGGTGCACTCTGCAGGACCAGGG + Intergenic
1058486108 9:105444965-105444987 ATGTGGATTCAGCTGGTCCAGGG + Intergenic
1058729220 9:107834034-107834056 AGGGGCATTCTGATGGAAGAGGG - Intergenic
1059539359 9:115115334-115115356 AGAAGCATTCAGAAGGAACACGG + Intronic
1060670132 9:125461475-125461497 AGGTGCATCCAAATGCAGCAAGG + Intronic
1187582000 X:20617067-20617089 AGGATCAATCAGATAGACCAGGG + Intergenic
1188343627 X:29036824-29036846 ATGTGCATTCTGATGTTCCAAGG + Intronic
1188524093 X:31071130-31071152 AGCTGCATGCAGATGGGGCAGGG + Intergenic
1188770495 X:34147841-34147863 AGCTGCATGCAGATGGGGCAGGG - Intergenic
1189035828 X:37492808-37492830 AGCTGCATGCAGATGGGGCAGGG - Intronic
1189037309 X:37506120-37506142 AGCTGCATGCAGATGGGGCAGGG - Intronic
1189108782 X:38265223-38265245 AGGTCCCTTCAGAGGGAGCATGG + Intronic
1190908624 X:54751512-54751534 AGGAGCAGCCAGGTGGACCATGG - Intronic
1199854395 X:151748417-151748439 AGCTGCATTTAGATGAACTATGG + Intergenic
1201311624 Y:12602933-12602955 AGGGGCCTTATGATGGACCAAGG + Intergenic
1201582009 Y:15519382-15519404 AGCTGCATTAGGATGAACCAGGG + Intergenic