ID: 1013836703

View in Genome Browser
Species Human (GRCh38)
Location 6:114342821-114342843
Sequence GCGCCCGCACAGCTTGGCAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 88}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013836703_1013836706 -5 Left 1013836703 6:114342821-114342843 CCGGTGCCAAGCTGTGCGGGCGC 0: 1
1: 0
2: 2
3: 2
4: 88
Right 1013836706 6:114342839-114342861 GGCGCCCCGCTCCCCGCGGCTGG 0: 1
1: 0
2: 1
3: 36
4: 306
1013836703_1013836705 -9 Left 1013836703 6:114342821-114342843 CCGGTGCCAAGCTGTGCGGGCGC 0: 1
1: 0
2: 2
3: 2
4: 88
Right 1013836705 6:114342835-114342857 TGCGGGCGCCCCGCTCCCCGCGG 0: 1
1: 0
2: 1
3: 15
4: 173
1013836703_1013836711 6 Left 1013836703 6:114342821-114342843 CCGGTGCCAAGCTGTGCGGGCGC 0: 1
1: 0
2: 2
3: 2
4: 88
Right 1013836711 6:114342850-114342872 CCCCGCGGCTGGCGCTGTCACGG 0: 1
1: 0
2: 1
3: 18
4: 104
1013836703_1013836714 17 Left 1013836703 6:114342821-114342843 CCGGTGCCAAGCTGTGCGGGCGC 0: 1
1: 0
2: 2
3: 2
4: 88
Right 1013836714 6:114342861-114342883 GCGCTGTCACGGCCGCCGCCCGG 0: 1
1: 0
2: 1
3: 21
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013836703 Original CRISPR GCGCCCGCACAGCTTGGCAC CGG (reversed) Exonic
900544026 1:3218514-3218536 CCGCCCGCACAGGTGGGCATCGG + Intronic
904575326 1:31501721-31501743 AGGACCCCACAGCTTGGCACTGG - Intergenic
904812280 1:33171135-33171157 ACGGCCACACAGCTTGACACAGG + Intronic
912132385 1:106619277-106619299 GCGCCCGCCCAACTTGGAAGGGG - Intergenic
1067247314 10:44557777-44557799 ATGCCCGCACAGCTTGGCAGAGG + Intergenic
1070774899 10:79103738-79103760 TCGCCCACACAGCCTGGCTCCGG - Intronic
1073185854 10:101614596-101614618 CTGCCCGCACAGCCTGGCAGGGG + Intronic
1075069031 10:119308651-119308673 GCTCCCCCACCGCGTGGCACAGG - Intronic
1075522950 10:123154847-123154869 GCGCACTGACAGCCTGGCACTGG - Intronic
1079362126 11:19777847-19777869 GCGCCCTCACAGCCTGTCCCGGG + Intronic
1081711542 11:45219708-45219730 GCGCCTGCACAGCATGTCCCAGG + Exonic
1083707277 11:64525208-64525230 CCCCCCGCACATCTGGGCACAGG + Intergenic
1083815631 11:65130880-65130902 GAGCCTGCACAGCAGGGCACAGG - Intronic
1094286446 12:28799415-28799437 GGGACCCCAGAGCTTGGCACTGG + Intergenic
1101835921 12:108295433-108295455 GTGCCTGCACCGTTTGGCACAGG - Intronic
1106413133 13:29524801-29524823 GCCCGGGCACAGCTGGGCACTGG + Intronic
1106559288 13:30834471-30834493 CGGCCCTCCCAGCTTGGCACAGG + Intergenic
1113371883 13:109732648-109732670 GCGGGCGCACAGCGTGGGACTGG - Intergenic
1113614420 13:111670750-111670772 GCGGCCGCAAAGCTGGGGACAGG + Intronic
1113619888 13:111755664-111755686 GCGGCCGCAAAGCTGGGGACAGG + Intergenic
1113797481 13:113066812-113066834 GGGCCCGCACAGCTGGACAGCGG + Intronic
1114155620 14:20099579-20099601 GCGGGCGCACAGCGTGGGACTGG + Intergenic
1114486033 14:23062228-23062250 CCACCCGCACAGCTCTGCACGGG - Exonic
1122569310 14:102683870-102683892 GCCCCCGCAGAGCTAGGGACTGG - Intronic
1124858114 15:33410700-33410722 GGCCCCGCACAGCATGGCAGTGG + Intronic
1128650653 15:69410436-69410458 GCACCTGCACTGCTAGGCACTGG + Intergenic
1129719625 15:77871093-77871115 GCACCCCCAGAGCCTGGCACAGG + Intergenic
1132365494 15:101253550-101253572 GCGCCCGGCCAGCTTTTCACTGG - Intergenic
1136519426 16:30786619-30786641 GCCCCCCCACCGCTTGGCTCCGG + Intronic
1138859594 16:60740493-60740515 GCTCCCACACAGTTTGGCAGGGG + Intergenic
1140469886 16:75208015-75208037 GCGCCAGCACACCTGGGCCCTGG + Intergenic
1143019133 17:3907614-3907636 GCCCCCTCTCACCTTGGCACTGG + Intronic
1149430612 17:56593702-56593724 GCGTCCGCGCACGTTGGCACCGG - Exonic
1149449333 17:56737739-56737761 GTGCCCACACAGCTCTGCACGGG - Intergenic
1154321412 18:13356306-13356328 GCGCCCGCAGCTCTTGGGACAGG + Intronic
1155097022 18:22566317-22566339 GAGCCCCCACTGCTTGGCATTGG - Intergenic
1160791401 19:925365-925387 CCGCCCGCCCAGCTCTGCACCGG + Intergenic
1160921332 19:1522233-1522255 GGGCTCGCACAGCCTGACACAGG + Intergenic
1161316866 19:3621296-3621318 CCGCCCACACAGCGGGGCACAGG + Intronic
1163699727 19:18781211-18781233 GCGCCCGCACGCCCTGGCCCAGG - Exonic
1165889393 19:39101377-39101399 GCGCCCACACAGCTGGGGTCAGG + Intronic
1166700698 19:44879846-44879868 GCCCCAGCACTGCCTGGCACAGG - Intronic
927965345 2:27264504-27264526 CCGCCCGCACACCTTGGCACGGG - Intronic
935375235 2:102388693-102388715 ACGCACGCACACATTGGCACGGG - Intronic
944276788 2:197848217-197848239 GCACCCACACTTCTTGGCACAGG + Intronic
945245317 2:207711934-207711956 GCGCCGGCCCAGCTTGGGGCTGG - Exonic
949035315 2:241813442-241813464 GAGCACGCACAGCCCGGCACAGG - Intronic
1169645287 20:7803538-7803560 GCGGGCGCACAGCCTGGGACTGG - Intergenic
1173006491 20:39143263-39143285 AAGCACACACAGCTTGGCACTGG + Intergenic
1176067656 20:63207033-63207055 TCTCCCGCACAGCCAGGCACAGG + Intronic
1179823804 21:43952607-43952629 GCGCCAGCACATCTTGGTCCTGG - Intronic
1180157558 21:45985580-45985602 GCGTCCCCACAGCTGGACACTGG - Intronic
1180200879 21:46223377-46223399 GTGCCCCCAGAGCCTGGCACGGG + Intronic
1183966913 22:41447516-41447538 ACTCCCGCACAGCGTGGCCCAGG - Intergenic
1185047592 22:48536878-48536900 GCCCCCGGACACCCTGGCACTGG + Intronic
1185384220 22:50524373-50524395 GGAGCCCCACAGCTTGGCACAGG - Exonic
953890686 3:46749997-46750019 GAGCCCACACAGCAGGGCACAGG + Intronic
954870814 3:53766296-53766318 GAGCCAGCTCAGCTGGGCACTGG + Intronic
955266393 3:57449324-57449346 GCGAGCGCACAGCGTGGGACTGG - Intronic
957682973 3:83461626-83461648 ACTTCCGCACAGTTTGGCACAGG - Intergenic
960184778 3:114625000-114625022 GCGACTGCACAGCTTGGCACAGG + Intronic
961403327 3:126662451-126662473 CCGCCTCCACAGCATGGCACCGG + Intergenic
966877643 3:184332370-184332392 GTGCCCCCACGGCGTGGCACAGG + Intronic
966901817 3:184492206-184492228 GCGCCTGGACAGGTTGGCATTGG + Intronic
968224686 3:196966438-196966460 GCGCCTGCAGAGTTTTGCACAGG - Intronic
969654910 4:8491388-8491410 GCGAGCGCACAGCGTGGCACTGG - Intronic
973617270 4:52691568-52691590 TCTCCCGCACAGTTTTGCACTGG - Intergenic
976276565 4:83284603-83284625 GCGCCCGCGCGGCTCGGGACAGG + Exonic
992131648 5:73698864-73698886 GTGCCTGCACTGGTTGGCACCGG + Intronic
992134006 5:73724027-73724049 GCCCCCGCAGACCCTGGCACAGG - Intronic
992228723 5:74642518-74642540 GCTCCCCCACACCTTGCCACAGG - Intronic
992434276 5:76740363-76740385 TCGCCCCCAGAGATTGGCACTGG - Intergenic
1004037039 6:11933464-11933486 GCGGGCGCACAGCGTGGGACTGG + Intergenic
1004044452 6:12011788-12011810 GCGCCGGCCCAGCTGGGCCCCGG + Intronic
1006385818 6:33730307-33730329 GAGACCGCTCAGCTAGGCACAGG - Intronic
1013836703 6:114342821-114342843 GCGCCCGCACAGCTTGGCACCGG - Exonic
1019323378 7:425611-425633 GGGCCCGCACACCTGGGGACCGG + Intergenic
1025962009 7:66231338-66231360 GCGAGCGCACAGCATGGGACTGG - Intronic
1034537926 7:151737612-151737634 GCGCCCCAGCAGCTTGCCACTGG + Intronic
1034883164 7:154777817-154777839 GAGCCCCCACAGCTGCGCACAGG - Intronic
1036418280 8:8571282-8571304 GAGGCCACACAGATTGGCACTGG + Intergenic
1036620763 8:10423457-10423479 GCACCTGCATAGCTTGGCCCCGG + Intronic
1037845625 8:22279437-22279459 GCATCCGTACAGCCTGGCACTGG - Exonic
1038267574 8:26048200-26048222 GCCCCCGCACAGCTCGGGGCAGG - Intergenic
1046804325 8:118463476-118463498 GGGCTCCCACTGCTTGGCACAGG + Intronic
1058174802 9:101724093-101724115 GCGGGCGCACAGCGTGGGACTGG - Intronic
1058235630 9:102486961-102486983 GCGGGCGCACAGCGTGGGACTGG - Intergenic
1060897063 9:127225011-127225033 GCGCCCGCTCAGCCTGTTACAGG - Intronic
1062088260 9:134659808-134659830 GTGCACACACAGCTGGGCACAGG - Intronic
1186849393 X:13565719-13565741 GGGCCCCCACTACTTGGCACAGG + Intergenic
1191878594 X:65822190-65822212 GCGCCGGCCCAGCTTGGGGCTGG + Intergenic
1195002965 X:100659878-100659900 GCACACACACAGCATGGCACGGG - Intronic
1201556366 Y:15267635-15267657 GTGGGCGCACAGCTTGGGACAGG + Intergenic