ID: 1013836723

View in Genome Browser
Species Human (GRCh38)
Location 6:114342887-114342909
Sequence AGCTGCCGGCTCGGGCGCTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013836723 Original CRISPR AGCTGCCGGCTCGGGCGCTC TGG (reversed) Exonic
900106038 1:981526-981548 GGCTGCCAGCTGGGGCGCACTGG - Intronic
900326491 1:2110900-2110922 ACCTTCCGGCTCGGTCTCTCAGG - Intronic
903738361 1:25544207-25544229 AGCTGCTGGCTGGGGCGCAGGGG - Intronic
904065194 1:27744412-27744434 AGCTGCCGGGCCGGGCGCGGTGG - Intronic
904236633 1:29121355-29121377 TGCTGCGGGCCCAGGCGCTCCGG - Exonic
905819730 1:40980026-40980048 AGCTGCCGGCTCCCGCGCGCGGG + Intronic
906193985 1:43918198-43918220 AGCTGCCGCCTCCAGGGCTCCGG + Intronic
909475204 1:76074600-76074622 AGCCGCCGGCGCCGGCGCCCAGG + Intergenic
911092908 1:94031875-94031897 AGCTGCGGGCCTGGGCACTCTGG + Exonic
912345883 1:108963160-108963182 AGCCGCCGGCGCGGGAGCTGAGG + Intronic
917970340 1:180201984-180202006 AGCTGCCGGCTGAGTCTCTCTGG + Exonic
918388717 1:184036910-184036932 GGCTGGCGGATCGGGCGGTCAGG - Intronic
919870910 1:201820579-201820601 AGCTGCCCGCTCCTGCCCTCTGG + Exonic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
923369455 1:233295669-233295691 AGCAGCCGGCTCCGGCGCCGCGG - Exonic
1066745995 10:38604551-38604573 AGGTGCCGGCACGTGCGCTGGGG - Intergenic
1067222219 10:44352545-44352567 AGCTGCCGGCTCCAAGGCTCAGG + Intergenic
1074682006 10:115916763-115916785 AGCTGCAGCCTTGGGAGCTCAGG + Intronic
1075375473 10:121974996-121975018 TCCTCCAGGCTCGGGCGCTCTGG + Exonic
1082025083 11:47565705-47565727 AGGTGCCGGGTCGGGCGCACCGG + Exonic
1084681747 11:70670429-70670451 AGATGCCAGCTCGGGCGCTTTGG + Intronic
1084973092 11:72781828-72781850 GGCTGGGGGCTCGGGGGCTCGGG + Intronic
1085640343 11:78189125-78189147 AGCAGCCGGCTCTGGCCCACCGG + Exonic
1094199152 12:27779900-27779922 AGCTGCGGGCCCGGGCGCCTCGG - Intergenic
1095261743 12:40105952-40105974 AGCCGCCGCCACGGCCGCTCCGG + Intronic
1096392358 12:51239145-51239167 AGCTGCGGGCTCGGGTGGTGGGG + Intronic
1104031900 12:125070867-125070889 AGCTGCCTCATCGGGCCCTCAGG - Intronic
1104676130 12:130713758-130713780 AGCTCCCGGGTCAGGCCCTCTGG + Intronic
1104983342 12:132583452-132583474 AGCTCCCCGCGCAGGCGCTCGGG - Exonic
1105578469 13:21673843-21673865 AGGTGCCCGCTCGGCCGCCCGGG + Intronic
1112561725 13:100521311-100521333 CGCTGCCGGCTCGGGACTTCAGG - Intronic
1113379008 13:109786321-109786343 CGCTGCCTCCTCGGGCTCTCGGG + Exonic
1113797993 13:113069884-113069906 ATCTGCGGGCGCGGGCACTCAGG - Intronic
1113887288 13:113667631-113667653 ACCTGCCGGCCCTGGAGCTCTGG + Exonic
1117131952 14:52695673-52695695 GGCTGCCGGCGCGGGCGCCGCGG - Exonic
1118514189 14:66508456-66508478 CGCTCCCGGCCCGCGCGCTCCGG + Exonic
1119520192 14:75279253-75279275 CGGTGCCGGCTCGGGGGCTCGGG + Intronic
1121018157 14:90561221-90561243 AGCTGCCGGCCCAGCCCCTCGGG - Intronic
1122094838 14:99363194-99363216 ACCTGCCGCCTCGGGACCTCAGG - Intergenic
1122145084 14:99684194-99684216 CGCCTCCGGCTCCGGCGCTCCGG - Intergenic
1122309193 14:100783803-100783825 GGCTGCCGGCTGGCCCGCTCTGG - Intergenic
1122796092 14:104206998-104207020 AGCTGCTGGCTCAGGCCCTTGGG + Intergenic
1123023037 14:105411202-105411224 AGCTCCCGGCGCGGGGCCTCAGG - Intronic
1125756014 15:42065518-42065540 AACTGCCGGCACGGATGCTCTGG - Intergenic
1132512823 16:352692-352714 CGCCGCCGGCGGGGGCGCTCGGG - Intergenic
1132729157 16:1352096-1352118 ACCTGCCGGCGCGGGCCCTACGG - Exonic
1133220131 16:4316205-4316227 GGCTGCGGGCTCCGGCGGTCGGG - Intronic
1136737068 16:32475093-32475115 AGGTGCCGGCACGTGCGCTGGGG + Intergenic
1142151532 16:88514598-88514620 AGATGCCAGCTCCGGGGCTCTGG + Intronic
1142215029 16:88825862-88825884 AGCTGCCGCCTCCGGCTATCTGG - Intronic
1203016003 16_KI270728v1_random:354484-354506 AGGTGCCGGCACGTGCGCTGGGG - Intergenic
1203034338 16_KI270728v1_random:627642-627664 AGGTGCCGGCACGTGCGCTGGGG - Intergenic
1142805237 17:2367929-2367951 CCCTGCCGGCTGGGGCCCTCAGG - Intronic
1142967717 17:3591616-3591638 CTCTGCCTGCTCGGGAGCTCGGG + Intronic
1145941163 17:28744082-28744104 AGCGGCCGGCACGGGCGAGCGGG - Exonic
1146654807 17:34628892-34628914 AGCTGCCTGATGGGGCCCTCTGG - Intronic
1147123871 17:38352420-38352442 AGTTGGCGGCTCTGGGGCTCGGG + Exonic
1148128182 17:45247527-45247549 AGCTGCCCGCTCGCCCCCTCCGG - Intergenic
1148146885 17:45371710-45371732 AGCAGCCGGCTCGCCCGCGCAGG + Intergenic
1151537761 17:74748524-74748546 GGCTGCAGGCCTGGGCGCTCCGG - Intergenic
1151828884 17:76538251-76538273 AGCGGCTGGCTCGGGGGCGCGGG - Intronic
1151854387 17:76710749-76710771 GGCCGCCGGCTCGGGGGCGCAGG + Exonic
1157719280 18:49911232-49911254 AGCTGCCGGCTCAGGATCTCTGG - Intronic
1160453184 18:78979285-78979307 AGCGGGCGGGGCGGGCGCTCCGG + Intergenic
1160535880 18:79591090-79591112 AGCTGCAGGGTGGGGGGCTCAGG - Intergenic
1160864316 19:1250324-1250346 AGCTGCCGGCGCGGGGCCCCCGG + Exonic
1161083796 19:2324447-2324469 AGCTGCTGGCTCGGGCTGCCTGG + Intronic
1168133819 19:54337540-54337562 GGCTGCCGGCCAGGGCGCTGGGG + Exonic
928511625 2:32009608-32009630 GGCTGCGGGCGCGGGGGCTCGGG + Intronic
929701408 2:44166331-44166353 CGCTGCCGGCGCCCGCGCTCAGG + Intergenic
932180629 2:69643438-69643460 AGCTCCCGGCTCGGGGGTCCCGG - Intronic
934308399 2:91843743-91843765 AGGTGCCGGCACGTGCGCTGGGG - Intergenic
935820256 2:106886775-106886797 AGCTGCCGGGCCGGGGGCGCGGG - Intronic
937218934 2:120330349-120330371 ACCTGCCTGCTCTGGCTCTCTGG + Intergenic
937221784 2:120346196-120346218 GGCTGCCCGGTCGGGCGCTGGGG + Exonic
938117570 2:128612324-128612346 AGATGCCAGCTCTGGGGCTCAGG - Intergenic
939178721 2:138780596-138780618 AGGCGGCGGCTCGGGCGCTTGGG + Intergenic
941104895 2:161341129-161341151 GGCCGCCGGCTCGGGGGCGCAGG + Intronic
944890313 2:204110417-204110439 AGCTTCCGGCACGGGGGCTGTGG - Intergenic
948150826 2:235743337-235743359 AGCTCCCGGCTCGGGAACTGAGG + Intronic
948766855 2:240226896-240226918 AGCTGCAGGCCCGGGGACTCAGG - Intergenic
948906453 2:240981942-240981964 AGCTGCCAGCTCTGGGGCTCAGG + Intronic
949009726 2:241671624-241671646 CGCTGCCTGCCCGGGCGCTGTGG + Intronic
1175657751 20:60786818-60786840 AGCTGACCGCACGGGAGCTCTGG - Intergenic
1175903012 20:62367373-62367395 GGCTCGGGGCTCGGGCGCTCGGG - Intergenic
1175985548 20:62762633-62762655 AGGGGCCGGCTCAGGGGCTCCGG - Exonic
1178673934 21:34615029-34615051 AGCAGCCCGCTGGGGCGCACAGG - Exonic
1178734466 21:35136554-35136576 AGCTGCTGGCTCAGTGGCTCTGG + Intronic
1178914050 21:36697310-36697332 AGCTGCCGGCTCCGGGCCTCTGG - Intergenic
1179522241 21:41953314-41953336 AGATGCCGGGGCGGGCGGTCCGG - Intronic
1180701577 22:17784235-17784257 AGCTGCCTGCTGAGGCGGTCTGG + Intergenic
1185229130 22:49670431-49670453 AGCTGCCGGCCCGGGTGCTAAGG + Intergenic
949970629 3:9399928-9399950 AGCTGCTGGCTCTGGAGCTCTGG + Intronic
950345365 3:12287950-12287972 AGCCGCCGCCTGGGGCGCTTGGG + Intronic
954327897 3:49873504-49873526 AGCTCCTGTCTCAGGCGCTCAGG + Intergenic
967732429 3:192918229-192918251 AGCTGCCGGCTCCGGTGTTACGG + Intergenic
968486782 4:866763-866785 AGCTCCCGGCCCGTGAGCTCAGG + Intronic
968514871 4:1011766-1011788 GGGTCCGGGCTCGGGCGCTCGGG - Intronic
969285732 4:6200734-6200756 AGCTGCCGGAGCGTGCGCACTGG + Intergenic
969675759 4:8613550-8613572 AGCTGCAGGCTCTGCGGCTCAGG + Intronic
970617396 4:17781100-17781122 GACTCCCGGCTCGGGCGCCCCGG + Intronic
972437246 4:39045335-39045357 GGGCGCCGGCTCCGGCGCTCGGG - Intronic
972740575 4:41882454-41882476 AGTAGCCGGCGCGGCCGCTCAGG - Intergenic
976068354 4:81215106-81215128 GGCTGCCGGCTCAGTCGCTCCGG + Exonic
985664812 5:1176584-1176606 AGCTGCGGGGTCGGGGGCGCAGG + Intergenic
992106298 5:73451493-73451515 AGTTGCCGGCCCGGGCGCGAGGG - Intergenic
993116213 5:83722421-83722443 AGCCGCCGGGACGGGGGCTCTGG + Intergenic
1000084738 5:157879413-157879435 AGCTGCTGGCCCGGGTGCTAAGG - Intergenic
1002339264 5:178504348-178504370 AGCTGCTGGCTCTGGGACTCAGG + Intronic
1002639001 5:180621815-180621837 AGCTGTCGGCTTGGCAGCTCAGG + Exonic
1006093062 6:31639537-31639559 AGGTCCCGGCTCAGGCTCTCGGG + Exonic
1013836723 6:114342887-114342909 AGCTGCCGGCTCGGGCGCTCTGG - Exonic
1019083748 6:169455052-169455074 AGCTGCAGGCCAGGGCGCTCAGG - Intergenic
1019708404 7:2507308-2507330 AGCTGCTGGCTCCCTCGCTCAGG - Intergenic
1028432774 7:90766873-90766895 AGCAGCCAGCTCTGCCGCTCTGG + Intronic
1028621459 7:92833444-92833466 CCCCGCCGGCTCAGGCGCTCGGG + Exonic
1033656768 7:143380610-143380632 ATCTGCTGGCTGGGGCGCTGGGG + Intergenic
1035285310 7:157802244-157802266 GGCTGCCGGGTCTGGCGCTGGGG - Intronic
1035312701 7:157979891-157979913 AGCTGCCCAGTCGGGGGCTCTGG - Intronic
1037748730 8:21666325-21666347 AGCAGCCGGCTCTGGCTCTTAGG - Intergenic
1058058497 9:100473051-100473073 AGCTGTCGGCGCGGGAGCTGGGG + Intronic
1059457771 9:114410606-114410628 AGATGCTGGCTCGGGCCTTCCGG + Intronic
1061377549 9:130235230-130235252 AGCTGCTGGCCCGGGCGACCTGG + Exonic
1186350226 X:8732304-8732326 AGCTGCGAGCCCGGGCGCTCCGG + Intergenic
1188446346 X:30256756-30256778 AGCTGTCAGCTCTGGCACTCTGG - Intergenic
1195651727 X:107291784-107291806 AGCTGCGGGGTCGGGGGCTAGGG + Intergenic