ID: 1013837845

View in Genome Browser
Species Human (GRCh38)
Location 6:114353806-114353828
Sequence ATGAGGAAGCAGAATGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013837842_1013837845 13 Left 1013837842 6:114353770-114353792 CCTCTTTAGAGGTAAAAATAGAG No data
Right 1013837845 6:114353806-114353828 ATGAGGAAGCAGAATGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013837845 Original CRISPR ATGAGGAAGCAGAATGTAGA GGG Intergenic
No off target data available for this crispr