ID: 1013840107

View in Genome Browser
Species Human (GRCh38)
Location 6:114381509-114381531
Sequence GTGCCACTGCTACACAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013840107_1013840109 10 Left 1013840107 6:114381509-114381531 CCAGGGCTGTGTAGCAGTGGCAC No data
Right 1013840109 6:114381542-114381564 CACTGCAACCTCCGCCTCCTGGG 0: 19244
1: 108653
2: 218193
3: 184354
4: 113169
1013840107_1013840108 9 Left 1013840107 6:114381509-114381531 CCAGGGCTGTGTAGCAGTGGCAC No data
Right 1013840108 6:114381541-114381563 TCACTGCAACCTCCGCCTCCTGG 0: 36336
1: 151275
2: 144706
3: 86384
4: 56890

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013840107 Original CRISPR GTGCCACTGCTACACAGCCC TGG (reversed) Intergenic
No off target data available for this crispr