ID: 1013842811

View in Genome Browser
Species Human (GRCh38)
Location 6:114418474-114418496
Sequence CAAGCTCAAGACAGTACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013842811_1013842814 14 Left 1013842811 6:114418474-114418496 CCTGCAGTACTGTCTTGAGCTTG No data
Right 1013842814 6:114418511-114418533 CCTAGAGACACACCTCACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013842811 Original CRISPR CAAGCTCAAGACAGTACTGC AGG (reversed) Intergenic
No off target data available for this crispr