ID: 1013842814

View in Genome Browser
Species Human (GRCh38)
Location 6:114418511-114418533
Sequence CCTAGAGACACACCTCACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013842810_1013842814 19 Left 1013842810 6:114418469-114418491 CCTCTCCTGCAGTACTGTCTTGA No data
Right 1013842814 6:114418511-114418533 CCTAGAGACACACCTCACCAAGG No data
1013842811_1013842814 14 Left 1013842811 6:114418474-114418496 CCTGCAGTACTGTCTTGAGCTTG No data
Right 1013842814 6:114418511-114418533 CCTAGAGACACACCTCACCAAGG No data
1013842809_1013842814 20 Left 1013842809 6:114418468-114418490 CCCTCTCCTGCAGTACTGTCTTG No data
Right 1013842814 6:114418511-114418533 CCTAGAGACACACCTCACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013842814 Original CRISPR CCTAGAGACACACCTCACCA AGG Intergenic
No off target data available for this crispr