ID: 1013851675

View in Genome Browser
Species Human (GRCh38)
Location 6:114523495-114523517
Sequence ATGGAAGCATAGAATTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 294}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013851673_1013851675 10 Left 1013851673 6:114523462-114523484 CCTTTATTTATTACTATGGTGGA 0: 1
1: 0
2: 0
3: 17
4: 178
Right 1013851675 6:114523495-114523517 ATGGAAGCATAGAATTATGAAGG 0: 1
1: 0
2: 0
3: 14
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013851675 Original CRISPR ATGGAAGCATAGAATTATGA AGG Intergenic
900311877 1:2037393-2037415 ATGGAAGCACCCATTTATGATGG - Intergenic
900993422 1:6108112-6108134 ATGGAGGCATAGAGGGATGATGG + Intronic
902364195 1:15960321-15960343 ATGTAATGATAGAATGATGATGG - Intronic
904264312 1:29309691-29309713 ATGGAGGCATAGAGAAATGAAGG + Intronic
905569932 1:38995575-38995597 ATGGAAAGATACAATTTTGAGGG - Intronic
905898086 1:41562013-41562035 AAGGAAGGAAAGAACTATGAAGG + Intronic
906188437 1:43879841-43879863 ATGGAAGGACAGGAGTATGATGG - Intronic
907953358 1:59205264-59205286 ATGGAAGCTGAGAATCAGGAAGG + Intergenic
909277766 1:73709800-73709822 ATGAAAGGACAGAACTATGAAGG + Intergenic
909368451 1:74857051-74857073 ATGGAAGAACAGAAATGTGATGG - Intergenic
910135715 1:83966689-83966711 ATAGAACCAAAGAAATATGATGG - Intronic
910951100 1:92648907-92648929 AGTTAAGCATAGAATTATCATGG - Intronic
911483904 1:98481437-98481459 TTGGAATCATAGAATTAGCATGG + Intergenic
911721087 1:101191996-101192018 ATGATAGCATTGAATCATGATGG + Intergenic
912715466 1:111980676-111980698 ATGGAAACATAGATTTCTTAGGG - Intronic
913969914 1:143406884-143406906 ATGGTAGCATTGAGATATGAAGG + Intergenic
914064288 1:144232478-144232500 ATGGTAGCATTGAGATATGAAGG + Intergenic
914114862 1:144733876-144733898 ATGGTAGCATTGAGATATGAAGG - Intergenic
914796852 1:150926924-150926946 ATGGAAGCAAAGTAATATAAGGG + Intronic
915153657 1:153856236-153856258 ATGGCAACAGAGAATTAAGATGG - Intronic
915703657 1:157822638-157822660 ATTGAATCATATACTTATGATGG - Intergenic
916712491 1:167424415-167424437 ATGGAAGTACAGACTTATGCGGG - Exonic
918026254 1:180750489-180750511 AAGGAAGAATTGAATTATGTAGG + Intronic
918469362 1:184855091-184855113 ATGGAATCATAGAACTAAAATGG + Intronic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918809897 1:189102590-189102612 ATGCAAACATACAATAATGATGG + Intergenic
919049140 1:192491630-192491652 ATAGAGGTATAGAATTATCAAGG + Intergenic
920437654 1:205958236-205958258 ATAGAGGCAGAGAAATATGAAGG - Intergenic
921949266 1:220912176-220912198 ATGGAAGCAGAGAATTTTTTTGG - Intergenic
922862235 1:228829296-228829318 AAGGAATGATAGAATTAGGAAGG + Intergenic
923736143 1:236609755-236609777 ATGGTAGCAAAGAATTATCCAGG + Intergenic
924086060 1:240453271-240453293 CTGGTAGAATAGAATTATGTGGG - Intronic
1066197537 10:33115722-33115744 ATGGAAGCTTAGATTGTTGAGGG - Intergenic
1066608510 10:37209357-37209379 GTGGAAGCTTACAATTATGGTGG + Intronic
1067865421 10:49900650-49900672 TTGGAGGCATAGGATAATGAGGG - Intronic
1070219971 10:74431114-74431136 ATGGTAGCTTAGACTTATGGTGG + Intronic
1071044235 10:81354427-81354449 ATGGTAGCATAGAAATACAAAGG - Intergenic
1071666176 10:87561014-87561036 ATGGAAGCCGAGAATTATAGAGG - Intergenic
1071753868 10:88513531-88513553 ATGGATTCATAGAGTGATGAAGG - Intronic
1072967118 10:99983142-99983164 ATGGAAGCATATTCTTTTGAAGG - Intronic
1073536512 10:104281516-104281538 ATGAAAGTATAGGGTTATGATGG + Intronic
1073615876 10:104994583-104994605 ATGGAAGAAAAGAATTACAAAGG - Intronic
1077315058 11:1915910-1915932 ATGGATGGATAGACTAATGATGG + Intergenic
1079116684 11:17644584-17644606 ATGGAAGCATTGAGTTTTGTGGG + Intronic
1079248429 11:18770224-18770246 CTGGAAGCAGATCATTATGATGG - Intronic
1080439068 11:32273731-32273753 ATGGATGTATTGATTTATGAAGG - Intergenic
1081249222 11:40809124-40809146 AGGGAAGCAGAGAATTGAGATGG - Intronic
1082125925 11:48430921-48430943 ATGAATGAATAGAATTATTAAGG - Intergenic
1086255264 11:84868183-84868205 ATGGAAGCATGTAACTATCATGG + Intronic
1086646314 11:89225642-89225664 ATGGAATCAAATAATTATGGTGG + Intronic
1086834759 11:91607086-91607108 ATGGAAGAATTGAAAGATGAGGG - Intergenic
1086979850 11:93183209-93183231 ATGGTTGCATATAATTATAATGG - Intronic
1086985855 11:93248473-93248495 ATGGAAGCAGAGACTTGAGAAGG + Intergenic
1087280267 11:96201937-96201959 ATGGAAGTATAGTACCATGAAGG + Intronic
1088006525 11:104947542-104947564 ATAGAAGCACAGAAAGATGAAGG + Intronic
1088442120 11:109882385-109882407 ATGGAAGCAGAGATGTAAGAAGG - Intergenic
1088931213 11:114352329-114352351 ATGGAAGCATTGAAAGATGTAGG + Intergenic
1089166647 11:116482612-116482634 ATGGAAGCATAAAGAGATGAAGG - Intergenic
1091489831 12:923493-923515 AAGGATGCAGTGAATTATGATGG + Intronic
1092099374 12:5870446-5870468 ATGACAGCATTGAACTATGAAGG + Intronic
1092964356 12:13627127-13627149 ATGGAAGGAGAGAAGAATGAAGG + Intronic
1093405798 12:18802425-18802447 ATGGAAGCAGAGAAAAAGGAAGG + Intergenic
1093666281 12:21817195-21817217 ATGGAGTCAGAGAACTATGAAGG - Exonic
1093975787 12:25420512-25420534 ATGAAAGAATAGAATCATAAAGG - Intronic
1094416662 12:30223479-30223501 CTGCAAGCATTGAATTAAGATGG - Intergenic
1094432827 12:30388739-30388761 CAGGAAGCTTACAATTATGATGG + Intergenic
1095281810 12:40360704-40360726 AAGCAAGCACTGAATTATGAAGG - Intronic
1096711969 12:53464284-53464306 AGGGAAGCAAAGAGGTATGAAGG - Intronic
1097719968 12:63009831-63009853 ATGGAAGCATAGCCTTATTCTGG + Intergenic
1098308660 12:69126146-69126168 ATGGAAGCACAGAATTTTGCAGG + Intergenic
1098649336 12:72944557-72944579 AGGGAAGCACAGAAAGATGAGGG - Intergenic
1100097515 12:91059850-91059872 TTGGAACCATAGAATCATGCAGG - Intergenic
1102168651 12:110825429-110825451 ATGGAAGTTTAGAAAAATGAAGG - Intergenic
1103851949 12:123939084-123939106 ATGGAAGCTTTGATTTATGTGGG - Intronic
1106611346 13:31285021-31285043 ATGGTCGCAAAGAATTATGAAGG - Intronic
1108517180 13:51214473-51214495 AAGGAAGAATGGAATTAAGATGG + Intergenic
1109040769 13:57333370-57333392 ATGAAAGAATAGAATCATTAAGG + Intergenic
1111029867 13:82582071-82582093 ATGGAAGAATTGAATTCTTAAGG + Intergenic
1111655172 13:91142764-91142786 ACGGAAGCACAGAAACATGAGGG - Intergenic
1111760186 13:92453720-92453742 ATGGAAGCATAGCATCAGAAAGG + Intronic
1112182286 13:97095401-97095423 ATGAAAGCATAGAACTACCAAGG + Intergenic
1113349899 13:109519034-109519056 AGGGAAGCAGAGAATTATATGGG + Intergenic
1114632709 14:24169765-24169787 ATAGGAGGATAGAATAATGACGG - Intergenic
1114690884 14:24580010-24580032 ATGGATGGATTGATTTATGATGG + Intergenic
1114819216 14:25996301-25996323 ATGAAAACATAGAAGAATGAAGG - Intergenic
1116207220 14:41883711-41883733 ATGTAGGCATAGAAATAAGACGG - Intronic
1116290284 14:43026444-43026466 CAGGAAGCCTACAATTATGATGG - Intergenic
1116607336 14:47017762-47017784 ATGGTAGCATAGATTTATATGGG - Intronic
1116980407 14:51164063-51164085 ATGGAAGCAGAGAATGCAGAGGG + Intergenic
1117477016 14:56105905-56105927 ATGGAAGTAAAGAATGGTGAAGG - Intergenic
1118948307 14:70409697-70409719 ATGGACACATTGTATTATGATGG - Intronic
1120213481 14:81657464-81657486 TGGGAAGAATAGAATTAGGACGG - Intergenic
1121019543 14:90570861-90570883 ATGGAAGCACAGAGAGATGAAGG + Intronic
1121295806 14:92821016-92821038 ATGGAGGCACAGAATGGTGATGG + Intronic
1124207211 15:27731784-27731806 ATAGATGCAGAGAATTCTGAGGG + Intergenic
1126332796 15:47551583-47551605 TTGGAAGCACAGAGATATGAAGG - Intronic
1126508355 15:49435319-49435341 ATGTAAGGACAAAATTATGAAGG + Intronic
1130146956 15:81281656-81281678 ATGGAAGCCCAGGATTATGAGGG - Intronic
1131455969 15:92582866-92582888 AAAGAAGCAAAGAATAATGAAGG + Intergenic
1131575675 15:93588280-93588302 AGGGAAGAATAGAAGTAGGAAGG - Intergenic
1131575682 15:93588324-93588346 AGGGAAGAATAGAAGTAGGAAGG - Intergenic
1132000206 15:98171480-98171502 ATGGAAGAATACAATTTTAAAGG - Intergenic
1134333532 16:13272163-13272185 ATGGAAGCATACAATTGAAATGG + Intergenic
1134341357 16:13349741-13349763 ATGGCATCTTAGAATCATGAAGG + Intergenic
1135008799 16:18854472-18854494 TTGAAAGCACAGAATTATAAAGG + Intronic
1136731840 16:32421640-32421662 ATTGAAGCATAGAATTTAAAAGG - Intergenic
1139047235 16:63076534-63076556 ATGGAAGCATAGAAGCAAGTTGG - Intergenic
1139102748 16:63788095-63788117 AAGGGAGGATCGAATTATGAGGG - Intergenic
1139232803 16:65302652-65302674 ATCTAAGCATATAATTTTGAGGG - Intergenic
1139564668 16:67766604-67766626 ATGGAAGCTTAAAATTATGGTGG - Intronic
1140135248 16:72199869-72199891 ATGGCAGCGTGGAATTAGGATGG + Intergenic
1141818758 16:86430903-86430925 ATGAAAGCATAGAATCAGGCTGG - Intergenic
1202994552 16_KI270728v1_random:95614-95636 ATTGAAGCATAGAATTTAAAAGG + Intergenic
1203021239 16_KI270728v1_random:407956-407978 ATTGAAGCATAGAATTTAAAAGG + Intergenic
1143068739 17:4271561-4271583 ATAGAGGCAGAGAAATATGAAGG + Exonic
1143100266 17:4500759-4500781 ATGGAAGGGAAGAATTCTGATGG + Intronic
1146335234 17:31963965-31963987 ATGGAAGAGTAGAACTATAAGGG - Intronic
1152296202 17:79468374-79468396 ATGGATGCATAGACAGATGATGG + Intronic
1154605024 18:16430798-16430820 ATTGAAGCATAGAATTTAAAAGG - Intergenic
1154937360 18:21074887-21074909 CTTGAAGAATAGAATTATGAAGG + Intronic
1154949663 18:21196815-21196837 CTGGAAGCATAGGATTGTGATGG - Intergenic
1159286240 18:66357535-66357557 ATAAAAGCATAGAAGAATGAAGG - Intergenic
1159802857 18:72922508-72922530 ATGAAGGCATAGAAATATAAAGG + Intergenic
1160105899 18:75975921-75975943 TTGGAAGCAGAGATTTATTAGGG + Intergenic
1164290109 19:23860196-23860218 ATGATTGCTTAGAATTATGATGG - Intergenic
925295276 2:2772319-2772341 GTGGAAGCAGAGACTAATGATGG - Intergenic
925532476 2:4880045-4880067 AAGGAAACAGAGAATTATGGAGG - Intergenic
926543243 2:14206804-14206826 ATGGAAGCAAAGAAGTAGGAAGG + Intergenic
928868938 2:35951595-35951617 ATGGAAGCACAGAATTTCCAAGG - Intergenic
929851354 2:45593397-45593419 GTGGAAGCAATGAATTATGGGGG + Intronic
930206254 2:48589043-48589065 ATGGTGGCACAGAATTATTAAGG + Intronic
932561870 2:72880103-72880125 ATGGCAACATATAATTTTGAGGG + Intergenic
932991130 2:76789307-76789329 ATGGAAGTGGAGAATTCTGAAGG - Intronic
933938692 2:87227647-87227669 ATGGAACCAGAGAGTTCTGATGG + Intergenic
934174606 2:89567797-89567819 ATGGTAGCATTGAGATATGAAGG + Intergenic
934284923 2:91642147-91642169 ATGGTAGCATTGAGATATGAAGG + Intergenic
934313883 2:91897625-91897647 ATTGAAGCATAGAATTTAAAAGG + Intergenic
936354443 2:111738126-111738148 ATGGAACCAGAGAGTTCTGATGG - Intergenic
937475615 2:122212447-122212469 ATGCAAGCATAGAAGTCTGATGG - Intergenic
939717838 2:145607475-145607497 ATGTAGGCAAAGAATAATGATGG + Intergenic
940219718 2:151339283-151339305 ATGGAAGAAGAGATTTTTGAGGG - Intergenic
941610296 2:167653535-167653557 CTGGAATCACAGAATTATCAAGG + Intergenic
941925426 2:170889518-170889540 CTGGGAGCTTAGAATTATCAAGG - Intergenic
942371270 2:175288059-175288081 ATAGAAGCATAGAAATAAGTAGG - Intergenic
942736378 2:179119065-179119087 ATGCAAGAATTGGATTATGAAGG + Intronic
943107823 2:183569178-183569200 ATTGCAGCATAAAAATATGAAGG + Intergenic
943135804 2:183911255-183911277 ATGGAAGTAAAGAAATTTGAAGG + Intergenic
944998770 2:205325258-205325280 ATGGCAGCATAAAAGTATAAAGG - Intronic
945414578 2:209555137-209555159 AATGAAGGATAGGATTATGACGG - Intronic
946590474 2:221241650-221241672 ATGGAATCATAAGATTGTGAAGG - Intergenic
947183177 2:227430987-227431009 ATGGACTAATACAATTATGAAGG - Intergenic
947253963 2:228140861-228140883 CTGGAAGCTTATAATCATGATGG - Intronic
1169100894 20:2948075-2948097 AAGGAAACATGGAATTCTGAAGG + Intronic
1171147973 20:22802457-22802479 ATGGAAGCAAAGAAGTCTGCAGG + Intergenic
1173188208 20:40857283-40857305 CAGGAAGCTTACAATTATGACGG - Intergenic
1173259828 20:41424099-41424121 ATAGAAGCAGAGAATCCTGAAGG + Intronic
1175318438 20:58068705-58068727 ATGGAAGCATTGAAGGATGCTGG + Intergenic
1176939314 21:14904550-14904572 ATGGAAACAGAGTATAATGATGG - Intergenic
1177030384 21:15975795-15975817 AAAGAACCAGAGAATTATGATGG - Intergenic
1177061959 21:16387000-16387022 AAGGTAGCACAGAATTATGAAGG - Intergenic
1177369815 21:20187714-20187736 ATGAAAACCTAGAATTATTATGG - Intergenic
1177799116 21:25809930-25809952 AAGGAAGCTTACAATCATGATGG - Intergenic
1178999547 21:37443951-37443973 ATTTGAGCATAGAATTTTGAGGG + Intronic
1179623673 21:42634925-42634947 ATGGATGGATAGAAGGATGATGG - Intergenic
1179623729 21:42635365-42635387 ATGGATGGATAGAAGGATGATGG - Intergenic
1179623741 21:42635471-42635493 ATGGATGGATAGAAGGATGATGG - Intergenic
1180540636 22:16443524-16443546 ATTGAAGCATAGAATTTAAAAGG + Intergenic
1181090496 22:20469271-20469293 ATGGACGCAGGGAATTAAGAAGG + Intronic
1181349943 22:22247717-22247739 ATGGAATCCCAGAATCATGAAGG - Intergenic
1181658289 22:24319251-24319273 CTGGAAACTTAGAATTATGGTGG + Intronic
1183065244 22:35358206-35358228 ATGGAATCATAGATTTAGGGAGG - Intergenic
949902528 3:8829318-8829340 ATGGCTGCAGAGAATAATGAGGG + Intronic
951807296 3:26660095-26660117 ATGGAGTAATATAATTATGAAGG - Intronic
952542703 3:34383647-34383669 ATTGCAGCAGAAAATTATGATGG - Intergenic
955105296 3:55892037-55892059 ATGGAAGCTGAGAAAGATGAAGG - Intronic
955566873 3:60256730-60256752 ATGTATGATTAGAATTATGATGG - Intronic
960131508 3:114061180-114061202 ATGCAAGCATAGAATCAGAATGG - Intronic
960613281 3:119574195-119574217 ATGGAAGCAGAGAATGTTCAAGG - Intergenic
963998271 3:151736953-151736975 ATGGATGCAGAGAAATAGGAAGG - Intronic
964017319 3:151963503-151963525 TTGGAAGCATGGAAAAATGATGG - Intergenic
964781009 3:160338083-160338105 ATGGCAGCATAGAAATAAGGTGG + Intronic
965282382 3:166770684-166770706 CAGGAAGCTTACAATTATGACGG + Intergenic
966006182 3:175015085-175015107 ATGGAAGCGTAGACATATAAAGG + Intronic
966478589 3:180379055-180379077 ATGTAAGAATAGAATTTTGGGGG + Intergenic
971059338 4:22949995-22950017 ATGGGATCATAGAATTCTAAAGG + Intergenic
972227713 4:37032974-37032996 ATGGAAGAATAGATATATGGGGG + Intergenic
972565152 4:40262937-40262959 AGGGAAGGAGAGAATTCTGATGG + Intergenic
972624871 4:40787073-40787095 ATGGAAGAATATAATAAAGATGG + Intronic
973538589 4:51910249-51910271 ATGGAAGCATATAAGAAAGACGG + Intronic
974806632 4:66888992-66889014 AAGGAAGCAGCAAATTATGAAGG - Intergenic
975124357 4:70765296-70765318 ATGGAATCATATAATAAAGACGG - Intronic
975921320 4:79393550-79393572 ATCTAAGCCTAGAATTCTGAAGG - Intergenic
977808577 4:101333013-101333035 ATAGAATCATAGACTTTTGAAGG - Intronic
978277542 4:106969839-106969861 GAGGAAGGTTAGAATTATGAGGG - Intronic
978489347 4:109295135-109295157 ATGAAAAAATAGAATTATTAAGG + Intronic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
979655512 4:123188759-123188781 ATAAAAGGATAGAATCATGAAGG + Intronic
979865049 4:125744084-125744106 ATGGAAAGATAGAATGAAGAAGG + Intergenic
980765399 4:137296884-137296906 ATGGACACATAAAATTATAATGG - Intergenic
981671382 4:147291218-147291240 ATGGAATCATAGAAATACTATGG - Intergenic
982057404 4:151566234-151566256 TTAGAAGCATTGATTTATGAAGG + Exonic
982910995 4:161143127-161143149 CAGGAAGCATAAAATTATGGTGG - Intergenic
983495805 4:168441253-168441275 TTGGAAGAATTGAATTATTAGGG + Intronic
983620364 4:169755069-169755091 ATAGAAGAATATAAATATGAGGG - Intronic
984652497 4:182285729-182285751 GTGGAAGCGTGGAATTGTGAAGG + Intronic
985689009 5:1296566-1296588 ATGGAAGCAGAAGATTATGCTGG + Intergenic
986048795 5:4067409-4067431 ATGGAAACATAGGATTTTGAGGG + Intergenic
986217052 5:5729230-5729252 AAAGAAGCAAAGAATTCTGAAGG - Intergenic
986911979 5:12568722-12568744 AAGGAAGCTTACAATCATGAGGG + Intergenic
987168726 5:15229762-15229784 AGGGAAGCATAAAGCTATGAAGG - Intergenic
988262889 5:28911860-28911882 GGGGAAGCTTAGAATTATGGTGG - Intergenic
989239162 5:39183609-39183631 ATGGAAGAATAGAGATATCAAGG - Intronic
990095648 5:52108838-52108860 AAGGAAGCATAGAAGGATAAAGG + Intergenic
990631403 5:57674419-57674441 CAGGAAACTTAGAATTATGATGG + Intergenic
990725216 5:58745506-58745528 ATGGAAGAATGGAAGTATCAGGG - Intronic
991432910 5:66567125-66567147 AGGGAAGCCTAGAAGTAGGATGG + Intergenic
991711224 5:69410757-69410779 ATGGAAGCATGGAATCACAAAGG + Intronic
992730372 5:79660364-79660386 ATGCAAGCATATTACTATGAGGG + Intronic
993240933 5:85383921-85383943 ATGTCATCATATAATTATGAAGG - Intergenic
993467433 5:88266488-88266510 ATGGAATCATAAATTTAAGAAGG + Intronic
995382170 5:111547618-111547640 ATGGAATCATTGGATTGTGAAGG - Intergenic
996649759 5:125860897-125860919 ATGCAATCATAAAATCATGATGG + Intergenic
998027979 5:138837252-138837274 TTGGAAGTATAAAATTGTGAAGG + Intronic
999215284 5:149928655-149928677 ATGGTCCCATAGAATTATAATGG - Intronic
999494744 5:152085754-152085776 ATGCTAACATGGAATTATGAAGG - Intergenic
999900461 5:156081109-156081131 CAGGAAGCATACAATTATGGTGG + Intronic
1000956463 5:167549833-167549855 ATGAATGCATAGAAGTATAATGG - Intronic
1001862832 5:175073578-175073600 ATGTATGCTTACAATTATGAAGG - Intergenic
1003379763 6:5613822-5613844 ATGAAAGCATGCTATTATGAGGG + Intronic
1004083564 6:12421260-12421282 ATAGAAGGATAGCATTTTGATGG + Intergenic
1004108219 6:12686471-12686493 ATGGATGCTTAGAAATATGTGGG + Intergenic
1004276224 6:14237501-14237523 ATGGAAGCATACAATCCAGAAGG - Intergenic
1005213165 6:23493125-23493147 TTGGAAGAGTAGAATGATGAAGG - Intergenic
1006979289 6:38133815-38133837 TTTGAAGCTTAGAAATATGAAGG + Intronic
1007016280 6:38470417-38470439 ATGGAAGCATAGGTTGAAGACGG + Intronic
1008320460 6:50105817-50105839 AAGGAGGCATTGAAATATGAAGG + Intergenic
1008400673 6:51059026-51059048 ATCGAAGTATAGAAACATGAGGG - Intergenic
1008547836 6:52598924-52598946 TTGGAAGCATTGAATTGTGGGGG + Intergenic
1009550953 6:65090355-65090377 AAGGAAACATACAATTATGGTGG - Intronic
1012373448 6:98532746-98532768 ATGGACTCATGAAATTATGAAGG - Intergenic
1012724306 6:102789299-102789321 ACAGAAGCATAAATTTATGATGG - Intergenic
1012823142 6:104114154-104114176 ATGGAAACTCAGAATGATGAGGG - Intergenic
1013153159 6:107466181-107466203 ATGACAGCTTAGAAGTATGAGGG - Intergenic
1013851675 6:114523495-114523517 ATGGAAGCATAGAATTATGAAGG + Intergenic
1014137377 6:117906081-117906103 ATGGAAGGATATAAATAAGATGG - Intergenic
1014628393 6:123759358-123759380 ATTGAAGCATATTATGATGATGG + Intergenic
1014800692 6:125775054-125775076 ATATAAGAATAGCATTATGATGG + Intergenic
1015003657 6:128251703-128251725 ATGGATACATAGAATTATGTGGG - Intronic
1015687796 6:135885109-135885131 AGAGAAGAATAGAAATATGATGG - Intronic
1016514757 6:144881568-144881590 TTGGAAAAATAGAATTAGGAAGG + Intergenic
1016647693 6:146428831-146428853 ATTAAAGAATAGAATTCTGATGG - Intronic
1017636013 6:156443932-156443954 ATGGAAGGATTAAAATATGATGG - Intergenic
1018491252 6:164295558-164295580 ATAGAAGCACAGAATCATAATGG - Intergenic
1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG + Intergenic
1020559238 7:9708989-9709011 AAGGAAGCATAAAATAATTAAGG + Intergenic
1022385317 7:29893412-29893434 ATGGAAATATAGAACAATGAAGG + Intronic
1027709246 7:81577337-81577359 ATGTAAGCACATAATTATAATGG + Intergenic
1027854513 7:83492231-83492253 ATGAAAGGATTCAATTATGAGGG + Intronic
1027865194 7:83637535-83637557 ATGGAGGTAATGAATTATGAAGG + Intronic
1028623631 7:92852175-92852197 ATGGATGCATTAAACTATGAGGG + Intergenic
1030347629 7:108452592-108452614 AGGGAAGCATAAAATTTTAAGGG + Intronic
1031863106 7:127005932-127005954 ATGGAAACATAGAAGGATGCTGG - Intronic
1032105137 7:129021778-129021800 ACGGAAGAATAGAATTGAGAAGG + Intronic
1032718282 7:134529444-134529466 ATTGAATGAAAGAATTATGAAGG + Intronic
1035318630 7:158013993-158014015 ATGGATGCATAGACAAATGATGG - Intronic
1035318675 7:158014185-158014207 ATGGATGCATAGACAAATGACGG - Intronic
1036621856 8:10429503-10429525 CAGGAAACTTAGAATTATGATGG + Intergenic
1038316154 8:26486014-26486036 ATTGACTCATGGAATTATGAAGG - Intronic
1038924725 8:32125965-32125987 ATGGAAGCATAGAGAAAAGAGGG - Intronic
1039179212 8:34845725-34845747 ATGGCAGGATTGAATTAAGATGG + Intergenic
1039376677 8:37041565-37041587 ATAGAAGGAAACAATTATGATGG + Intergenic
1041573310 8:59363759-59363781 TCTGAAGCATAGAATTAGGATGG - Intergenic
1042345176 8:67719676-67719698 ATGCAGGCATAAAATAATGACGG + Intronic
1043158258 8:76814032-76814054 ACGGAAGAATAGCATGATGACGG - Intronic
1043667390 8:82833186-82833208 TAGTAAGCATAGAGTTATGAGGG + Intergenic
1044218765 8:89645489-89645511 ATGGAAGCCCAGAGTGATGAAGG - Intergenic
1044842563 8:96349717-96349739 ATGGGAGAATAGACTTAAGAAGG - Intergenic
1045559205 8:103244675-103244697 CTGTAAGCACAGAATGATGAAGG + Intergenic
1046297661 8:112242989-112243011 ATGGATACTTAGAATTAGGAGGG + Intronic
1046786199 8:118269520-118269542 ATGGAAGCCTAAAATTAGAAAGG - Intronic
1048158824 8:131992254-131992276 ATCAAAGCATATGATTATGAAGG + Intronic
1048339450 8:133527439-133527461 ATGTCAGCTTAGAATAATGACGG + Intronic
1048457112 8:134588195-134588217 ATGGAAGCACAAAATTAGAAAGG + Intronic
1048753778 8:137711495-137711517 AGGGAGGCATACAATAATGAAGG - Intergenic
1050989299 9:12127808-12127830 ATAGAAGCATAGAAAAATGGCGG - Intergenic
1052683823 9:31729030-31729052 ATAGAAACATAAAATAATGAGGG - Intergenic
1056147673 9:83749901-83749923 ATGGAAACATAAAAATATAATGG + Intronic
1056256235 9:84802365-84802387 CTTGAACCAAAGAATTATGAAGG + Intronic
1056713914 9:89013006-89013028 ATAGAAACACAGAATTGTGAGGG - Intergenic
1057273109 9:93661699-93661721 ATGGATGGATGGAATAATGAAGG + Intronic
1057432780 9:95009723-95009745 CTGGCAGAAAAGAATTATGAAGG - Intronic
1061255583 9:129453153-129453175 ATGGAAGGATGGAAGGATGAAGG + Intergenic
1185752416 X:2624013-2624035 ATTGAAGTATATAATTATGTGGG - Intergenic
1192931569 X:75811781-75811803 CAGGAAGCTTAAAATTATGATGG - Intergenic
1194171654 X:90592562-90592584 TTGGAAAAATAGAATTCTGATGG - Intergenic
1196183000 X:112715510-112715532 ATGGAAAGAAAGAATTATGTAGG + Intergenic
1197629746 X:128844684-128844706 TTGGAAACATAGAAATAAGAAGG + Intergenic
1197698514 X:129577076-129577098 ATGGAAGCATAGAACTATCCTGG + Intronic
1198329387 X:135607794-135607816 ATGCAAGCATAGTGTCATGAAGG + Intergenic
1199034857 X:143037873-143037895 AAGGAAACTTAGAATTATGATGG - Intergenic
1199441902 X:147877940-147877962 TAGGAAGCTTACAATTATGATGG - Intergenic
1200517885 Y:4170312-4170334 TTGGAAAAATAGAATTCTGATGG - Intergenic
1200700203 Y:6395628-6395650 ATGAAAGCAAAGAAAAATGAAGG + Intergenic
1200706117 Y:6443940-6443962 ATGAAAGCAAAGAAAAATGAAGG + Intergenic
1200781612 Y:7221361-7221383 ATGGATGAATAGAAATATAATGG + Intergenic
1201027993 Y:9720768-9720790 ATGAAAGCAAAGAAAAATGAAGG - Intergenic
1201033908 Y:9769070-9769092 ATGAAAGCAAAGAAAAATGAAGG - Intergenic
1201181793 Y:11355113-11355135 ATTGAAGCATAGAATTTAAAAGG + Intergenic
1201942792 Y:19477794-19477816 CTGGAGGCCAAGAATTATGAGGG - Intergenic