ID: 1013856037

View in Genome Browser
Species Human (GRCh38)
Location 6:114573360-114573382
Sequence ACTAAGACCTTGAGCAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013856035_1013856037 12 Left 1013856035 6:114573325-114573347 CCTGCTATTCCAATGTTTGAATT No data
Right 1013856037 6:114573360-114573382 ACTAAGACCTTGAGCAGTGCTGG No data
1013856036_1013856037 3 Left 1013856036 6:114573334-114573356 CCAATGTTTGAATTCACTGCTGA No data
Right 1013856037 6:114573360-114573382 ACTAAGACCTTGAGCAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013856037 Original CRISPR ACTAAGACCTTGAGCAGTGC TGG Intergenic
No off target data available for this crispr