ID: 1013856092

View in Genome Browser
Species Human (GRCh38)
Location 6:114574107-114574129
Sequence GTGGTAAATACAACCACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013856092_1013856099 -5 Left 1013856092 6:114574107-114574129 CCCCCAGTGGTTGTATTTACCAC No data
Right 1013856099 6:114574125-114574147 ACCACTTACAATGATGGCTGGGG No data
1013856092_1013856101 -2 Left 1013856092 6:114574107-114574129 CCCCCAGTGGTTGTATTTACCAC No data
Right 1013856101 6:114574128-114574150 ACTTACAATGATGGCTGGGGTGG No data
1013856092_1013856098 -6 Left 1013856092 6:114574107-114574129 CCCCCAGTGGTTGTATTTACCAC No data
Right 1013856098 6:114574124-114574146 TACCACTTACAATGATGGCTGGG No data
1013856092_1013856097 -7 Left 1013856092 6:114574107-114574129 CCCCCAGTGGTTGTATTTACCAC No data
Right 1013856097 6:114574123-114574145 TTACCACTTACAATGATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013856092 Original CRISPR GTGGTAAATACAACCACTGG GGG (reversed) Intergenic
No off target data available for this crispr