ID: 1013858212

View in Genome Browser
Species Human (GRCh38)
Location 6:114601588-114601610
Sequence CAAGGTAAATTGAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013858204_1013858212 24 Left 1013858204 6:114601541-114601563 CCTCTGCTAGCTGCTATGCTAGG No data
Right 1013858212 6:114601588-114601610 CAAGGTAAATTGAGGGAGGCAGG No data
1013858203_1013858212 25 Left 1013858203 6:114601540-114601562 CCCTCTGCTAGCTGCTATGCTAG No data
Right 1013858212 6:114601588-114601610 CAAGGTAAATTGAGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013858212 Original CRISPR CAAGGTAAATTGAGGGAGGC AGG Intergenic
No off target data available for this crispr