ID: 1013859977

View in Genome Browser
Species Human (GRCh38)
Location 6:114624098-114624120
Sequence GATTGGAGCAGGAGGTAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013859977_1013859982 -9 Left 1013859977 6:114624098-114624120 CCTGGTTACCTCCTGCTCCAATC No data
Right 1013859982 6:114624112-114624134 GCTCCAATCGAGTGTTTGGTGGG No data
1013859977_1013859981 -10 Left 1013859977 6:114624098-114624120 CCTGGTTACCTCCTGCTCCAATC No data
Right 1013859981 6:114624111-114624133 TGCTCCAATCGAGTGTTTGGTGG No data
1013859977_1013859986 26 Left 1013859977 6:114624098-114624120 CCTGGTTACCTCCTGCTCCAATC No data
Right 1013859986 6:114624147-114624169 CACAGTATGATTCATGGTCCAGG No data
1013859977_1013859985 20 Left 1013859977 6:114624098-114624120 CCTGGTTACCTCCTGCTCCAATC No data
Right 1013859985 6:114624141-114624163 TTCAGTCACAGTATGATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013859977 Original CRISPR GATTGGAGCAGGAGGTAACC AGG (reversed) Intergenic
No off target data available for this crispr