ID: 1013859978

View in Genome Browser
Species Human (GRCh38)
Location 6:114624106-114624128
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013859978_1013859986 18 Left 1013859978 6:114624106-114624128 CCTCCTGCTCCAATCGAGTGTTT No data
Right 1013859986 6:114624147-114624169 CACAGTATGATTCATGGTCCAGG No data
1013859978_1013859985 12 Left 1013859978 6:114624106-114624128 CCTCCTGCTCCAATCGAGTGTTT No data
Right 1013859985 6:114624141-114624163 TTCAGTCACAGTATGATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013859978 Original CRISPR AAACACTCGATTGGAGCAGG AGG (reversed) Intergenic
No off target data available for this crispr