ID: 1013859983

View in Genome Browser
Species Human (GRCh38)
Location 6:114624115-114624137
Sequence GTGCCCACCAAACACTCGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013859983_1013859985 3 Left 1013859983 6:114624115-114624137 CCAATCGAGTGTTTGGTGGGCAC No data
Right 1013859985 6:114624141-114624163 TTCAGTCACAGTATGATTCATGG No data
1013859983_1013859986 9 Left 1013859983 6:114624115-114624137 CCAATCGAGTGTTTGGTGGGCAC No data
Right 1013859986 6:114624147-114624169 CACAGTATGATTCATGGTCCAGG No data
1013859983_1013859987 26 Left 1013859983 6:114624115-114624137 CCAATCGAGTGTTTGGTGGGCAC No data
Right 1013859987 6:114624164-114624186 TCCAGGCTCTTTCCATCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013859983 Original CRISPR GTGCCCACCAAACACTCGAT TGG (reversed) Intergenic
No off target data available for this crispr