ID: 1013859986

View in Genome Browser
Species Human (GRCh38)
Location 6:114624147-114624169
Sequence CACAGTATGATTCATGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013859983_1013859986 9 Left 1013859983 6:114624115-114624137 CCAATCGAGTGTTTGGTGGGCAC No data
Right 1013859986 6:114624147-114624169 CACAGTATGATTCATGGTCCAGG No data
1013859978_1013859986 18 Left 1013859978 6:114624106-114624128 CCTCCTGCTCCAATCGAGTGTTT No data
Right 1013859986 6:114624147-114624169 CACAGTATGATTCATGGTCCAGG No data
1013859977_1013859986 26 Left 1013859977 6:114624098-114624120 CCTGGTTACCTCCTGCTCCAATC No data
Right 1013859986 6:114624147-114624169 CACAGTATGATTCATGGTCCAGG No data
1013859980_1013859986 15 Left 1013859980 6:114624109-114624131 CCTGCTCCAATCGAGTGTTTGGT No data
Right 1013859986 6:114624147-114624169 CACAGTATGATTCATGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013859986 Original CRISPR CACAGTATGATTCATGGTCC AGG Intergenic
No off target data available for this crispr