ID: 1013866279

View in Genome Browser
Species Human (GRCh38)
Location 6:114700576-114700598
Sequence ATGCATACCAAGAAACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013866279_1013866281 -2 Left 1013866279 6:114700576-114700598 CCTTCCTGTTTCTTGGTATGCAT No data
Right 1013866281 6:114700597-114700619 ATACTACTGTCTTACACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013866279 Original CRISPR ATGCATACCAAGAAACAGGA AGG (reversed) Intergenic
No off target data available for this crispr