ID: 1013883536

View in Genome Browser
Species Human (GRCh38)
Location 6:114933942-114933964
Sequence CAGGTGTGCTGGGGGACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013883531_1013883536 -8 Left 1013883531 6:114933927-114933949 CCTCTGAATTAGGTTCAGGTGTG No data
Right 1013883536 6:114933942-114933964 CAGGTGTGCTGGGGGACCCAAGG No data
1013883528_1013883536 1 Left 1013883528 6:114933918-114933940 CCTCTGGACCCTCTGAATTAGGT No data
Right 1013883536 6:114933942-114933964 CAGGTGTGCTGGGGGACCCAAGG No data
1013883530_1013883536 -7 Left 1013883530 6:114933926-114933948 CCCTCTGAATTAGGTTCAGGTGT No data
Right 1013883536 6:114933942-114933964 CAGGTGTGCTGGGGGACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013883536 Original CRISPR CAGGTGTGCTGGGGGACCCA AGG Intergenic
No off target data available for this crispr