ID: 1013890608 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:115021850-115021872 |
Sequence | CAAAATGCTGATAATGATAT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1013890608_1013890611 | 4 | Left | 1013890608 | 6:115021850-115021872 | CCCATATCATTATCAGCATTTTG | No data | ||
Right | 1013890611 | 6:115021877-115021899 | AAGCCATTCAACAAGTCTCTAGG | No data | ||||
1013890608_1013890612 | 5 | Left | 1013890608 | 6:115021850-115021872 | CCCATATCATTATCAGCATTTTG | No data | ||
Right | 1013890612 | 6:115021878-115021900 | AGCCATTCAACAAGTCTCTAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1013890608 | Original CRISPR | CAAAATGCTGATAATGATAT GGG (reversed) | Intergenic | ||