ID: 1013890608

View in Genome Browser
Species Human (GRCh38)
Location 6:115021850-115021872
Sequence CAAAATGCTGATAATGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013890608_1013890611 4 Left 1013890608 6:115021850-115021872 CCCATATCATTATCAGCATTTTG No data
Right 1013890611 6:115021877-115021899 AAGCCATTCAACAAGTCTCTAGG No data
1013890608_1013890612 5 Left 1013890608 6:115021850-115021872 CCCATATCATTATCAGCATTTTG No data
Right 1013890612 6:115021878-115021900 AGCCATTCAACAAGTCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013890608 Original CRISPR CAAAATGCTGATAATGATAT GGG (reversed) Intergenic