ID: 1013893161

View in Genome Browser
Species Human (GRCh38)
Location 6:115050780-115050802
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013893156_1013893161 17 Left 1013893156 6:115050740-115050762 CCTTAATATCGAAGAAGGCAATC No data
Right 1013893161 6:115050780-115050802 AACGGATGGTTGGAGTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013893161 Original CRISPR AACGGATGGTTGGAGTATGG AGG Intergenic
No off target data available for this crispr