ID: 1013899001

View in Genome Browser
Species Human (GRCh38)
Location 6:115129779-115129801
Sequence CAGGTTTATTTTGAGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013899001_1013899008 25 Left 1013899001 6:115129779-115129801 CCCTTCTCCTCAAAATAAACCTG No data
Right 1013899008 6:115129827-115129849 CCTCCATAGATCTGTCAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013899001 Original CRISPR CAGGTTTATTTTGAGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr