ID: 1013900051

View in Genome Browser
Species Human (GRCh38)
Location 6:115144265-115144287
Sequence CTGAAGCAGAAGAATCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013900047_1013900051 10 Left 1013900047 6:115144232-115144254 CCTTCTCAACTCCTAAACCCTGC No data
Right 1013900051 6:115144265-115144287 CTGAAGCAGAAGAATCAGAGAGG No data
1013900049_1013900051 -7 Left 1013900049 6:115144249-115144271 CCCTGCTCACTTACATCTGAAGC No data
Right 1013900051 6:115144265-115144287 CTGAAGCAGAAGAATCAGAGAGG No data
1013900050_1013900051 -8 Left 1013900050 6:115144250-115144272 CCTGCTCACTTACATCTGAAGCA No data
Right 1013900051 6:115144265-115144287 CTGAAGCAGAAGAATCAGAGAGG No data
1013900048_1013900051 -1 Left 1013900048 6:115144243-115144265 CCTAAACCCTGCTCACTTACATC No data
Right 1013900051 6:115144265-115144287 CTGAAGCAGAAGAATCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013900051 Original CRISPR CTGAAGCAGAAGAATCAGAG AGG Intergenic
No off target data available for this crispr