ID: 1013901185

View in Genome Browser
Species Human (GRCh38)
Location 6:115157680-115157702
Sequence TTTAATGTATAGACAGCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013901185_1013901186 12 Left 1013901185 6:115157680-115157702 CCAATAGCTGTCTATACATTAAA No data
Right 1013901186 6:115157715-115157737 CATCCTCAAACTCTCTTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013901185 Original CRISPR TTTAATGTATAGACAGCTAT TGG (reversed) Intergenic
No off target data available for this crispr