ID: 1013908191

View in Genome Browser
Species Human (GRCh38)
Location 6:115240886-115240908
Sequence ACTTCAGGAGTGAAGCTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013908189_1013908191 4 Left 1013908189 6:115240859-115240881 CCTTCTGGTGGGTTTGTGGTCTC No data
Right 1013908191 6:115240886-115240908 ACTTCAGGAGTGAAGCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013908191 Original CRISPR ACTTCAGGAGTGAAGCTTTG TGG Intergenic