ID: 1013916959

View in Genome Browser
Species Human (GRCh38)
Location 6:115352157-115352179
Sequence CTTTTATTCCACATCTTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013916959_1013916961 9 Left 1013916959 6:115352157-115352179 CCCATAAAGATGTGGAATAAAAG No data
Right 1013916961 6:115352189-115352211 ATTTTAAAGTGAAAAATGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013916959 Original CRISPR CTTTTATTCCACATCTTTAT GGG (reversed) Intergenic
No off target data available for this crispr