ID: 1013920385

View in Genome Browser
Species Human (GRCh38)
Location 6:115396242-115396264
Sequence CTGGTTATACCATCAGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013920385_1013920390 -5 Left 1013920385 6:115396242-115396264 CCCACACCTGATGGTATAACCAG No data
Right 1013920390 6:115396260-115396282 ACCAGTGGAGGCTGCAGCGATGG No data
1013920385_1013920392 15 Left 1013920385 6:115396242-115396264 CCCACACCTGATGGTATAACCAG No data
Right 1013920392 6:115396280-115396302 TGGCTGCCTACTCCCTCCTCTGG No data
1013920385_1013920393 16 Left 1013920385 6:115396242-115396264 CCCACACCTGATGGTATAACCAG No data
Right 1013920393 6:115396281-115396303 GGCTGCCTACTCCCTCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013920385 Original CRISPR CTGGTTATACCATCAGGTGT GGG (reversed) Intergenic
No off target data available for this crispr