ID: 1013921439

View in Genome Browser
Species Human (GRCh38)
Location 6:115409236-115409258
Sequence CAGTAAGATATGCTGACTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013921439_1013921442 29 Left 1013921439 6:115409236-115409258 CCACAAGTCAGCATATCTTACTG No data
Right 1013921442 6:115409288-115409310 TTTACTAATACTGACAAACAGGG No data
1013921439_1013921443 30 Left 1013921439 6:115409236-115409258 CCACAAGTCAGCATATCTTACTG No data
Right 1013921443 6:115409289-115409311 TTACTAATACTGACAAACAGGGG No data
1013921439_1013921441 28 Left 1013921439 6:115409236-115409258 CCACAAGTCAGCATATCTTACTG No data
Right 1013921441 6:115409287-115409309 CTTTACTAATACTGACAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013921439 Original CRISPR CAGTAAGATATGCTGACTTG TGG (reversed) Intergenic
No off target data available for this crispr