ID: 1013921439 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:115409236-115409258 |
| Sequence | CAGTAAGATATGCTGACTTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1013921439_1013921442 | 29 | Left | 1013921439 | 6:115409236-115409258 | CCACAAGTCAGCATATCTTACTG | No data | ||
| Right | 1013921442 | 6:115409288-115409310 | TTTACTAATACTGACAAACAGGG | No data | ||||
| 1013921439_1013921443 | 30 | Left | 1013921439 | 6:115409236-115409258 | CCACAAGTCAGCATATCTTACTG | No data | ||
| Right | 1013921443 | 6:115409289-115409311 | TTACTAATACTGACAAACAGGGG | No data | ||||
| 1013921439_1013921441 | 28 | Left | 1013921439 | 6:115409236-115409258 | CCACAAGTCAGCATATCTTACTG | No data | ||
| Right | 1013921441 | 6:115409287-115409309 | CTTTACTAATACTGACAAACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1013921439 | Original CRISPR | CAGTAAGATATGCTGACTTG TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||