ID: 1013921439 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:115409236-115409258 |
Sequence | CAGTAAGATATGCTGACTTG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1013921439_1013921441 | 28 | Left | 1013921439 | 6:115409236-115409258 | CCACAAGTCAGCATATCTTACTG | No data | ||
Right | 1013921441 | 6:115409287-115409309 | CTTTACTAATACTGACAAACAGG | No data | ||||
1013921439_1013921442 | 29 | Left | 1013921439 | 6:115409236-115409258 | CCACAAGTCAGCATATCTTACTG | No data | ||
Right | 1013921442 | 6:115409288-115409310 | TTTACTAATACTGACAAACAGGG | No data | ||||
1013921439_1013921443 | 30 | Left | 1013921439 | 6:115409236-115409258 | CCACAAGTCAGCATATCTTACTG | No data | ||
Right | 1013921443 | 6:115409289-115409311 | TTACTAATACTGACAAACAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1013921439 | Original CRISPR | CAGTAAGATATGCTGACTTG TGG (reversed) | Intergenic | ||