ID: 1013921441

View in Genome Browser
Species Human (GRCh38)
Location 6:115409287-115409309
Sequence CTTTACTAATACTGACAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013921439_1013921441 28 Left 1013921439 6:115409236-115409258 CCACAAGTCAGCATATCTTACTG No data
Right 1013921441 6:115409287-115409309 CTTTACTAATACTGACAAACAGG No data
1013921440_1013921441 -4 Left 1013921440 6:115409268-115409290 CCTTGTTTATTATTTTTTTCTTT No data
Right 1013921441 6:115409287-115409309 CTTTACTAATACTGACAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013921441 Original CRISPR CTTTACTAATACTGACAAAC AGG Intergenic
No off target data available for this crispr