ID: 1013922215

View in Genome Browser
Species Human (GRCh38)
Location 6:115419799-115419821
Sequence CAGAAGGAGGAGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013922208_1013922215 10 Left 1013922208 6:115419766-115419788 CCAGCTTGGGTGACAGACTTACA No data
Right 1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG No data
1013922206_1013922215 21 Left 1013922206 6:115419755-115419777 CCCACTGCATGCCAGCTTGGGTG No data
Right 1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG No data
1013922207_1013922215 20 Left 1013922207 6:115419756-115419778 CCACTGCATGCCAGCTTGGGTGA 0: 13
1: 410
2: 8821
3: 102682
4: 188538
Right 1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013922215 Original CRISPR CAGAAGGAGGAGGAGGAGGA GGG Intergenic
No off target data available for this crispr