ID: 1013931155

View in Genome Browser
Species Human (GRCh38)
Location 6:115534610-115534632
Sequence GCCTGTAATCCCAGCACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1038702
Summary {0: 215700, 1: 270647, 2: 186590, 3: 142154, 4: 223611}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013931155_1013931161 16 Left 1013931155 6:115534610-115534632 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1013931161 6:115534649-115534671 AGCCATTGTTAAGTTTAAAGAGG No data
1013931155_1013931162 17 Left 1013931155 6:115534610-115534632 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1013931162 6:115534650-115534672 GCCATTGTTAAGTTTAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013931155 Original CRISPR GCCTGTAATCCCAGCACTTT GGG (reversed) Intergenic
Too many off-targets to display for this crispr