ID: 1013931156

View in Genome Browser
Species Human (GRCh38)
Location 6:115534611-115534633
Sequence CGCCTGTAATCCCAGCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 988408
Summary {0: 121435, 1: 268139, 2: 223994, 3: 153979, 4: 220861}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013931156_1013931161 15 Left 1013931156 6:115534611-115534633 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 1013931161 6:115534649-115534671 AGCCATTGTTAAGTTTAAAGAGG No data
1013931156_1013931162 16 Left 1013931156 6:115534611-115534633 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 1013931162 6:115534650-115534672 GCCATTGTTAAGTTTAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013931156 Original CRISPR CGCCTGTAATCCCAGCACTT TGG (reversed) Intergenic
Too many off-targets to display for this crispr