ID: 1013931162

View in Genome Browser
Species Human (GRCh38)
Location 6:115534650-115534672
Sequence GCCATTGTTAAGTTTAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013931155_1013931162 17 Left 1013931155 6:115534610-115534632 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1013931162 6:115534650-115534672 GCCATTGTTAAGTTTAAAGAGGG No data
1013931151_1013931162 26 Left 1013931151 6:115534601-115534623 CCTTGGCCTCCCAAAGTGCTGGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
Right 1013931162 6:115534650-115534672 GCCATTGTTAAGTTTAAAGAGGG No data
1013931153_1013931162 20 Left 1013931153 6:115534607-115534629 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1013931162 6:115534650-115534672 GCCATTGTTAAGTTTAAAGAGGG No data
1013931149_1013931162 30 Left 1013931149 6:115534597-115534619 CCTGCCTTGGCCTCCCAAAGTGC 0: 56485
1: 171609
2: 226607
3: 184242
4: 115036
Right 1013931162 6:115534650-115534672 GCCATTGTTAAGTTTAAAGAGGG No data
1013931156_1013931162 16 Left 1013931156 6:115534611-115534633 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 1013931162 6:115534650-115534672 GCCATTGTTAAGTTTAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013931162 Original CRISPR GCCATTGTTAAGTTTAAAGA GGG Intergenic
No off target data available for this crispr