ID: 1013935380

View in Genome Browser
Species Human (GRCh38)
Location 6:115587496-115587518
Sequence CCCCTGTAGCAACTTTTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013935380_1013935388 19 Left 1013935380 6:115587496-115587518 CCAGGCAAAAGTTGCTACAGGGG No data
Right 1013935388 6:115587538-115587560 CTCTGCTAGCACAGTGCAGAAGG No data
1013935380_1013935384 -9 Left 1013935380 6:115587496-115587518 CCAGGCAAAAGTTGCTACAGGGG No data
Right 1013935384 6:115587510-115587532 CTACAGGGGCAGGGCCCTCATGG 0: 13
1: 240
2: 677
3: 1148
4: 1517
1013935380_1013935390 30 Left 1013935380 6:115587496-115587518 CCAGGCAAAAGTTGCTACAGGGG No data
Right 1013935390 6:115587549-115587571 CAGTGCAGAAGGGAAATGTGAGG 0: 649
1: 1048
2: 1398
3: 1324
4: 1391
1013935380_1013935389 20 Left 1013935380 6:115587496-115587518 CCAGGCAAAAGTTGCTACAGGGG No data
Right 1013935389 6:115587539-115587561 TCTGCTAGCACAGTGCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013935380 Original CRISPR CCCCTGTAGCAACTTTTGCC TGG (reversed) Intergenic
No off target data available for this crispr