ID: 1013942407

View in Genome Browser
Species Human (GRCh38)
Location 6:115680652-115680674
Sequence AGTTATCAGAAGACCATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013942407_1013942408 -7 Left 1013942407 6:115680652-115680674 CCTGTCATGGTCTTCTGATAACT No data
Right 1013942408 6:115680668-115680690 GATAACTTAAGTTGCCCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013942407 Original CRISPR AGTTATCAGAAGACCATGAC AGG (reversed) Intergenic
No off target data available for this crispr