ID: 1013946165

View in Genome Browser
Species Human (GRCh38)
Location 6:115725254-115725276
Sequence GCTCTGAGCAGACCAATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013946165_1013946170 8 Left 1013946165 6:115725254-115725276 CCTGTTATTGGTCTGCTCAGAGC No data
Right 1013946170 6:115725285-115725307 CTTCCTGGTTTAATCTAGGAGGG 0: 165
1: 309
2: 847
3: 6277
4: 4697
1013946165_1013946172 23 Left 1013946165 6:115725254-115725276 CCTGTTATTGGTCTGCTCAGAGC No data
Right 1013946172 6:115725300-115725322 TAGGAGGGTTGTATATTTCCAGG 0: 161
1: 558
2: 595
3: 439
4: 656
1013946165_1013946166 -7 Left 1013946165 6:115725254-115725276 CCTGTTATTGGTCTGCTCAGAGC No data
Right 1013946166 6:115725270-115725292 TCAGAGCCTCTGTTTCTTCCTGG No data
1013946165_1013946168 4 Left 1013946165 6:115725254-115725276 CCTGTTATTGGTCTGCTCAGAGC No data
Right 1013946168 6:115725281-115725303 GTTTCTTCCTGGTTTAATCTAGG 0: 26
1: 312
2: 1757
3: 10844
4: 6267
1013946165_1013946169 7 Left 1013946165 6:115725254-115725276 CCTGTTATTGGTCTGCTCAGAGC No data
Right 1013946169 6:115725284-115725306 TCTTCCTGGTTTAATCTAGGAGG 0: 163
1: 311
2: 730
3: 617
4: 520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013946165 Original CRISPR GCTCTGAGCAGACCAATAAC AGG (reversed) Intergenic
No off target data available for this crispr