ID: 1013946169

View in Genome Browser
Species Human (GRCh38)
Location 6:115725284-115725306
Sequence TCTTCCTGGTTTAATCTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2341
Summary {0: 163, 1: 311, 2: 730, 3: 617, 4: 520}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013946165_1013946169 7 Left 1013946165 6:115725254-115725276 CCTGTTATTGGTCTGCTCAGAGC No data
Right 1013946169 6:115725284-115725306 TCTTCCTGGTTTAATCTAGGAGG 0: 163
1: 311
2: 730
3: 617
4: 520
1013946163_1013946169 24 Left 1013946163 6:115725237-115725259 CCATTTCAATCTCACTGCCTGTT No data
Right 1013946169 6:115725284-115725306 TCTTCCTGGTTTAATCTAGGAGG 0: 163
1: 311
2: 730
3: 617
4: 520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013946169 Original CRISPR TCTTCCTGGTTTAATCTAGG AGG Intergenic
Too many off-targets to display for this crispr