ID: 1013946170

View in Genome Browser
Species Human (GRCh38)
Location 6:115725285-115725307
Sequence CTTCCTGGTTTAATCTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 12295
Summary {0: 165, 1: 309, 2: 847, 3: 6277, 4: 4697}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013946163_1013946170 25 Left 1013946163 6:115725237-115725259 CCATTTCAATCTCACTGCCTGTT No data
Right 1013946170 6:115725285-115725307 CTTCCTGGTTTAATCTAGGAGGG 0: 165
1: 309
2: 847
3: 6277
4: 4697
1013946165_1013946170 8 Left 1013946165 6:115725254-115725276 CCTGTTATTGGTCTGCTCAGAGC No data
Right 1013946170 6:115725285-115725307 CTTCCTGGTTTAATCTAGGAGGG 0: 165
1: 309
2: 847
3: 6277
4: 4697

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013946170 Original CRISPR CTTCCTGGTTTAATCTAGGA GGG Intergenic
Too many off-targets to display for this crispr