ID: 1013946172

View in Genome Browser
Species Human (GRCh38)
Location 6:115725300-115725322
Sequence TAGGAGGGTTGTATATTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2409
Summary {0: 161, 1: 558, 2: 595, 3: 439, 4: 656}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013946167_1013946172 1 Left 1013946167 6:115725276-115725298 CCTCTGTTTCTTCCTGGTTTAAT No data
Right 1013946172 6:115725300-115725322 TAGGAGGGTTGTATATTTCCAGG 0: 161
1: 558
2: 595
3: 439
4: 656
1013946165_1013946172 23 Left 1013946165 6:115725254-115725276 CCTGTTATTGGTCTGCTCAGAGC No data
Right 1013946172 6:115725300-115725322 TAGGAGGGTTGTATATTTCCAGG 0: 161
1: 558
2: 595
3: 439
4: 656

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013946172 Original CRISPR TAGGAGGGTTGTATATTTCC AGG Intergenic
Too many off-targets to display for this crispr