ID: 1013952601

View in Genome Browser
Species Human (GRCh38)
Location 6:115802699-115802721
Sequence ATGAGCTAGTGGAAGAGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013952597_1013952601 15 Left 1013952597 6:115802661-115802683 CCATTGAAAGAAAAGTCTGTTGG No data
Right 1013952601 6:115802699-115802721 ATGAGCTAGTGGAAGAGTAATGG No data
1013952596_1013952601 18 Left 1013952596 6:115802658-115802680 CCTCCATTGAAAGAAAAGTCTGT No data
Right 1013952601 6:115802699-115802721 ATGAGCTAGTGGAAGAGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013952601 Original CRISPR ATGAGCTAGTGGAAGAGTAA TGG Intergenic
No off target data available for this crispr