ID: 1013957072

View in Genome Browser
Species Human (GRCh38)
Location 6:115853825-115853847
Sequence CAGGTTCACCAATCCAATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013957072_1013957076 7 Left 1013957072 6:115853825-115853847 CCTACATTGGATTGGTGAACCTG No data
Right 1013957076 6:115853855-115853877 TTAGGAGAATGGAACCATATTGG No data
1013957072_1013957075 -4 Left 1013957072 6:115853825-115853847 CCTACATTGGATTGGTGAACCTG No data
Right 1013957075 6:115853844-115853866 CCTGAAAGTGATTAGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013957072 Original CRISPR CAGGTTCACCAATCCAATGT AGG (reversed) Intergenic
No off target data available for this crispr