ID: 1013958215

View in Genome Browser
Species Human (GRCh38)
Location 6:115865800-115865822
Sequence ATTTGAGGAGGAGCTGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013958215_1013958222 7 Left 1013958215 6:115865800-115865822 CCCAGGGCAGCTCCTCCTCAAAT No data
Right 1013958222 6:115865830-115865852 CAAGCGCAGCATTCATGATGGGG No data
1013958215_1013958221 6 Left 1013958215 6:115865800-115865822 CCCAGGGCAGCTCCTCCTCAAAT No data
Right 1013958221 6:115865829-115865851 CCAAGCGCAGCATTCATGATGGG No data
1013958215_1013958223 8 Left 1013958215 6:115865800-115865822 CCCAGGGCAGCTCCTCCTCAAAT No data
Right 1013958223 6:115865831-115865853 AAGCGCAGCATTCATGATGGGGG No data
1013958215_1013958219 5 Left 1013958215 6:115865800-115865822 CCCAGGGCAGCTCCTCCTCAAAT No data
Right 1013958219 6:115865828-115865850 GCCAAGCGCAGCATTCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013958215 Original CRISPR ATTTGAGGAGGAGCTGCCCT GGG (reversed) Intergenic