ID: 1013958762

View in Genome Browser
Species Human (GRCh38)
Location 6:115872330-115872352
Sequence ATGCTTTGAGTGAGGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013958762_1013958767 20 Left 1013958762 6:115872330-115872352 CCATTTTTCCTCACTCAAAGCAT No data
Right 1013958767 6:115872373-115872395 CACACCACAGAGCTGCAGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013958762 Original CRISPR ATGCTTTGAGTGAGGAAAAA TGG (reversed) Intergenic
No off target data available for this crispr