ID: 1013960705

View in Genome Browser
Species Human (GRCh38)
Location 6:115896387-115896409
Sequence GTGACCAAAAGCAGCACTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013960704_1013960705 3 Left 1013960704 6:115896361-115896383 CCGGTTAAAAAAACACACTAATC No data
Right 1013960705 6:115896387-115896409 GTGACCAAAAGCAGCACTATAGG No data
1013960703_1013960705 14 Left 1013960703 6:115896350-115896372 CCATGAATCTTCCGGTTAAAAAA No data
Right 1013960705 6:115896387-115896409 GTGACCAAAAGCAGCACTATAGG No data
1013960702_1013960705 15 Left 1013960702 6:115896349-115896371 CCCATGAATCTTCCGGTTAAAAA No data
Right 1013960705 6:115896387-115896409 GTGACCAAAAGCAGCACTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013960705 Original CRISPR GTGACCAAAAGCAGCACTAT AGG Intergenic
No off target data available for this crispr