ID: 1013961164

View in Genome Browser
Species Human (GRCh38)
Location 6:115902099-115902121
Sequence CAGCAGCTCCAGATGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013961158_1013961164 26 Left 1013961158 6:115902050-115902072 CCTGCCAGTGCAGCTCATTCAGT No data
Right 1013961164 6:115902099-115902121 CAGCAGCTCCAGATGGAAGATGG No data
1013961159_1013961164 22 Left 1013961159 6:115902054-115902076 CCAGTGCAGCTCATTCAGTAGCC No data
Right 1013961164 6:115902099-115902121 CAGCAGCTCCAGATGGAAGATGG No data
1013961160_1013961164 1 Left 1013961160 6:115902075-115902097 CCATCATCACAGTGAACTCTATC No data
Right 1013961164 6:115902099-115902121 CAGCAGCTCCAGATGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013961164 Original CRISPR CAGCAGCTCCAGATGGAAGA TGG Intergenic
No off target data available for this crispr