ID: 1013967095

View in Genome Browser
Species Human (GRCh38)
Location 6:115967914-115967936
Sequence GTGCCTGACTTCCCAAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013967095_1013967100 26 Left 1013967095 6:115967914-115967936 CCAGATCTTGGGAAGTCAGGCAC 0: 1
1: 0
2: 2
3: 7
4: 121
Right 1013967100 6:115967963-115967985 ACCTAATGCCATCCTCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013967095 Original CRISPR GTGCCTGACTTCCCAAGATC TGG (reversed) Intronic
900188471 1:1343607-1343629 GTGCCTGCCTGCCCAGGGTCAGG + Intronic
900797004 1:4713990-4714012 GTGCCTGCCTGCCCAAGATGAGG - Intronic
901242190 1:7702009-7702031 CTGCCTGACTTTCCAAGAAAGGG + Intronic
905023749 1:34836116-34836138 TTGCCTGAGTACCCAAGATAGGG - Intronic
905059770 1:35129929-35129951 ATCCCTGATTTCCCAAGATTTGG - Intergenic
906613169 1:47217481-47217503 GTGCCTGACTGCCCAGCATTTGG - Exonic
907574330 1:55512618-55512640 GTTCCTGAGTTCCTAAGAACTGG + Intergenic
912271488 1:108214527-108214549 TTCCCTAACTTCCCACGATCTGG - Intergenic
922580058 1:226690424-226690446 GAGCCTGACAGCCCCAGATCAGG - Intronic
1064346904 10:14540721-14540743 GTTCCTGACTTCCCAAGCTCTGG + Intronic
1066692055 10:38039302-38039324 CAGCCTGACTTCCCAGGCTCAGG + Intronic
1067000653 10:42609335-42609357 CAGCCTGACTTCCCAGGCTCAGG - Intronic
1068865423 10:61889897-61889919 GTGCCTAACTTTTCAAGGTCTGG - Intergenic
1069063485 10:63918441-63918463 GAGCTTGCCTTCCCAAGCTCAGG - Intergenic
1069761432 10:70814312-70814334 TGGCCTGACTTGCCCAGATCAGG - Intergenic
1071250667 10:83815923-83815945 ATGCCTGGCTTCTCAAGACCTGG - Intergenic
1073583225 10:104686189-104686211 GAGCCTCACTTCCAAAGAACAGG - Intronic
1076334393 10:129695807-129695829 GGGCGTGGCTTCCCAAGCTCTGG + Intronic
1077429809 11:2510770-2510792 GTGCCAGCCTTCCCAGGACCTGG - Intronic
1078484146 11:11706225-11706247 GTGCCTGAGCTACTAAGATCAGG + Intergenic
1081910307 11:46695974-46695996 ATGCCTGACTTCCCCAAGTCAGG - Exonic
1082998698 11:59272825-59272847 GTGCCTCAGTTCCCAAGAACAGG - Intergenic
1083613427 11:64015103-64015125 GTGCCTCCCTTCCCCAGAGCTGG - Intronic
1085159833 11:74329900-74329922 TTGCCTGCCTTTCCCAGATCAGG - Intergenic
1087411926 11:97802060-97802082 GTGACAGACTTCCTTAGATCGGG + Intergenic
1089175121 11:116543020-116543042 CTGCTTGACTTCTCTAGATCTGG - Intergenic
1094244973 12:28279512-28279534 GTGCCTCCCTTCCCAGGGTCAGG - Intronic
1096230203 12:49892548-49892570 TTGCCTGGCTTCTCAACATCTGG + Intronic
1101814284 12:108134003-108134025 GTCCCTATCTTCCCAACATCTGG - Intronic
1103207823 12:119144049-119144071 GTGCCCGCCTTCCCAAGTGCTGG + Intronic
1104089980 12:125508303-125508325 GTGGCTGACCTACAAAGATCAGG - Intronic
1104277974 12:127347467-127347489 GTCCCTGACTTCCCACAATAGGG + Intergenic
1107072212 13:36283088-36283110 ATTCCTGACTTTCCAAGATATGG + Intronic
1107591730 13:41914771-41914793 GTGCCTGACCTTCCATTATCTGG + Intronic
1110126493 13:71949581-71949603 GTTGCTGTCTTCCCAATATCTGG - Intergenic
1110754951 13:79161735-79161757 GTGGCTGATTTCCCAGCATCTGG - Intergenic
1114158400 14:20133601-20133623 TGGCCTGACTTCCCAGGCTCAGG + Intergenic
1114832574 14:26163151-26163173 CTCCCTGACCTCCCAGGATCAGG + Intergenic
1116243041 14:42371310-42371332 TGGCCTGATTTCCCAAGATAAGG + Intergenic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1117178973 14:53173284-53173306 CTGCCTGACTTGCCCACATCTGG + Intergenic
1118865718 14:69702066-69702088 GTGCCTGACTGTCCAAGATAAGG - Intronic
1122365312 14:101191735-101191757 GTGACTCAGTTCCCAAGAGCAGG + Intergenic
1122796812 14:104210184-104210206 CTGGCTGACTTCCCAAGACGGGG - Intergenic
1127817729 15:62626583-62626605 GTCGCTGACTTGCCCAGATCAGG - Intronic
1128690819 15:69723628-69723650 GTGCCTTGCTTCCCAAGCCCTGG + Intergenic
1132128153 15:99248336-99248358 GAGCCGGAATTCCCAAAATCAGG - Intronic
1134031717 16:10997221-10997243 ATGCCTGTAATCCCAAGATCTGG - Intronic
1137628471 16:49924307-49924329 GGGACTGACTTCCCAAGCCCTGG - Intergenic
1139935633 16:70568946-70568968 GTGGCTGACTTGCAAAGACCTGG + Intronic
1143353883 17:6310089-6310111 GATCCTGGCTTCCCATGATCTGG + Intergenic
1143952310 17:10643197-10643219 TTTCCTGAGTTCCCAAGGTCTGG + Intronic
1146608666 17:34285603-34285625 CTGCTTGACTTCCTAGGATCTGG + Intergenic
1148818015 17:50344949-50344971 GTGCCTGGCTTCCCCAGCTGGGG + Intergenic
1150222597 17:63505552-63505574 GTGACTGAGTTCTCAGGATCTGG + Intronic
1150772504 17:68053469-68053491 GTCCCACACTTCCCAAGCTCTGG + Intergenic
1150902139 17:69292025-69292047 AGCCCTGACTTCCCAAGCTCAGG - Intronic
1151563155 17:74881597-74881619 GAGCCTGGCCTCCCAAGCTCGGG + Intronic
1159285109 18:66338477-66338499 GTGAGTGAGTTCACAAGATCTGG - Intergenic
1161968247 19:7561014-7561036 GTGCTTGCCTTCCCAAGCTCTGG + Exonic
1166863225 19:45821544-45821566 GGGTCTGAGTTCCCCAGATCGGG + Intronic
1202635960 1_KI270706v1_random:44628-44650 GTCCCTGATCTCCCAAAATCTGG - Intergenic
925911971 2:8579717-8579739 GTGGCTGACTTCAAAAGAGCAGG + Intergenic
928438362 2:31270864-31270886 CTGCCTGTCTTCCTTAGATCAGG - Intergenic
932720747 2:74137700-74137722 GTTCCTGACTTGCCCTGATCCGG + Intronic
932783322 2:74577775-74577797 GTGCCTGACTTCTCCATTTCCGG + Intronic
938055155 2:128208957-128208979 CTGCCTGACTGCCCACCATCTGG + Intergenic
942108631 2:172658212-172658234 GTCCCTGACTTCCCAAAACATGG - Intergenic
945791468 2:214310660-214310682 ATTCCTGACTTCCCAGGATGGGG - Intronic
1169038080 20:2470118-2470140 GTGCCTGACTTCTCAGGCGCTGG - Intronic
1170649039 20:18223074-18223096 GTCCCTCAGTTCCCAAGATGTGG - Intergenic
1171019295 20:21570741-21570763 GGGCCCCACTTCCCAAGATCTGG + Intergenic
1173902311 20:46600095-46600117 TTGACTGACTTCACAAGATTTGG - Intronic
1176373697 21:6077109-6077131 CTGCCTGACTTCCCAGGAAGAGG + Intergenic
1179372567 21:40819918-40819940 GGGCCTTAATTCCCAAGAACAGG + Intronic
1179749780 21:43461134-43461156 CTGCCTGACTTCCCAGGAAGAGG - Intergenic
1180364754 22:11928612-11928634 GTCCCTGATCTCCCAAAATCTGG + Intergenic
1181461605 22:23089142-23089164 GTGCCTGACTTCCTCAGAGACGG - Intronic
1181880416 22:25975007-25975029 ATGCCTGGCTTCCAAAGTTCTGG + Intronic
1182300028 22:29332029-29332051 GTGCCAGCCTTCCCATGTTCTGG + Intronic
1182737838 22:32543708-32543730 GTGCCTGAGTCTCCAAGCTCTGG + Intronic
950059569 3:10059093-10059115 GTTCTTGACTTCCCAGGCTCAGG + Intronic
950389742 3:12687141-12687163 ATCCTTGACTTCCCAGGATCAGG - Intergenic
952666025 3:35905422-35905444 GTGCCTGAATTCCAAAGAGAGGG + Intergenic
955504828 3:59621314-59621336 CACCCTGACTTCCCAGGATCAGG + Intergenic
955760621 3:62277670-62277692 GTGCTTTACTTACCAAGCTCTGG - Exonic
956234057 3:67047380-67047402 GTGCCTGACAGCGAAAGATCAGG + Intergenic
962532248 3:136293783-136293805 GTGACAGACTTCACAACATCAGG - Exonic
964577750 3:158193968-158193990 GTGTCAGACTCCCCAAGTTCTGG - Intronic
967046265 3:185739935-185739957 AGCCCTGACTTCCCAAGTTCAGG + Intronic
967427568 3:189345005-189345027 ATGTCTGACTTCACATGATCAGG + Intergenic
968627973 4:1636709-1636731 GTGCGTGCCTGCCCAAGACCTGG + Intronic
969807453 4:9620643-9620665 GTGCCTCACTTCCAAATATGTGG - Intergenic
970650138 4:18168541-18168563 ATGACTGACTCCCCATGATCTGG - Intergenic
972319970 4:37964547-37964569 GTGCCTGCCTTCCCGAGATCCGG + Intronic
982860753 4:160445915-160445937 GTGCCTAACTTGCCAACAGCAGG + Intergenic
983907498 4:173199282-173199304 GAGCCAGACTGCCCAAGTTCAGG + Intronic
1202763279 4_GL000008v2_random:130491-130513 GTCCCTGATCTCCCAAAATCTGG - Intergenic
986148281 5:5101464-5101486 GTGGCTGCCCTCCAAAGATCAGG + Intergenic
993309047 5:86305482-86305504 TTCCCTAACTTCCCACGATCTGG + Intergenic
994267829 5:97738871-97738893 GGGCCTGCCTTCCCTTGATCTGG - Intergenic
996389380 5:122943394-122943416 GTTACTGACTTCCCATCATCTGG + Intronic
998029008 5:138847588-138847610 GTGCCTGAAATCCCACCATCAGG - Intronic
998158878 5:139801934-139801956 GTGCCTGACTTCCCTTCAGCGGG + Intronic
1000354865 5:160384724-160384746 GTGCCTGACCTGCCAACAGCAGG + Intergenic
1003714271 6:8629049-8629071 ATGCCAGACTGCCCAAGATCAGG - Intergenic
1004086504 6:12454564-12454586 GTCCCTGACTTCCCACAATAAGG + Intergenic
1006395056 6:33781860-33781882 TTGCCTGACTCCCCGAGAGCAGG + Intronic
1013330648 6:109096404-109096426 TTCCCTGACTTTCCAAGATTGGG - Intronic
1013705580 6:112830005-112830027 GTGCCCAACTTCTCCAGATCAGG - Intergenic
1013967095 6:115967914-115967936 GTGCCTGACTTCCCAAGATCTGG - Intronic
1017836938 6:158187321-158187343 GTGCCAGACTCCCCTGGATCAGG + Intronic
1019881471 7:3865127-3865149 GTTCATCACTTCCCAAGATGGGG - Intronic
1026163289 7:67889117-67889139 GTGCCTGGCTTACCACGGTCTGG + Intergenic
1026879049 7:73896992-73897014 GAACCTGACTTTCCAACATCTGG - Intergenic
1035684388 8:1512858-1512880 GGGCCTCACTTTCCAGGATCAGG - Intronic
1038503605 8:28065271-28065293 CTGCCTGACTCCCCAGGAGCTGG + Intronic
1040573394 8:48628859-48628881 GTGACTCACTTCCAAAGAACAGG - Intergenic
1041024870 8:53673759-53673781 GAGCCTGACTTGCTGAGATCAGG + Intergenic
1042494521 8:69441116-69441138 GTGACTGACTTACTAAGTTCAGG + Intergenic
1045156799 8:99485032-99485054 GTTCCTGACTTTACAAGAGCTGG - Intronic
1045377024 8:101584764-101584786 CTACCTGACTTCCCAACATGTGG - Intronic
1057695852 9:97322650-97322672 GTTCCTGACATCCCAAGATAAGG - Intronic
1060666642 9:125435810-125435832 GCCCCTCACTTCCCCAGATCAGG - Intergenic
1061149945 9:128822906-128822928 GTGCCTGGCTGCCCGAGACCTGG + Intronic
1203544042 Un_KI270743v1:115362-115384 GTCCCTGATCTCCCAAAATCTGG - Intergenic
1186352730 X:8756772-8756794 GAGCCTGTCTTCCCAAGGTGGGG - Intergenic
1187225701 X:17374284-17374306 GAGGCTGCATTCCCAAGATCTGG + Intergenic
1187359334 X:18610172-18610194 ATTCCAGACTTCCCATGATCTGG + Intronic
1193813571 X:86080674-86080696 GTGCCTGACGTCACAATGTCTGG + Intergenic
1198740021 X:139832295-139832317 TTGGCTCACTTCCCAAGTTCTGG - Intronic