ID: 1013968061

View in Genome Browser
Species Human (GRCh38)
Location 6:115979880-115979902
Sequence AAGTGTACTCACACAAACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 537
Summary {0: 1, 1: 5, 2: 66, 3: 153, 4: 312}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013968061_1013968065 9 Left 1013968061 6:115979880-115979902 CCTAGGTTTGTGTGAGTACACTT 0: 1
1: 5
2: 66
3: 153
4: 312
Right 1013968065 6:115979912-115979934 CACACAATGGACTCACCTAATGG No data
1013968061_1013968063 -4 Left 1013968061 6:115979880-115979902 CCTAGGTTTGTGTGAGTACACTT 0: 1
1: 5
2: 66
3: 153
4: 312
Right 1013968063 6:115979899-115979921 ACTTGGTAATGTCCACACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013968061 Original CRISPR AAGTGTACTCACACAAACCT AGG (reversed) Intronic
901582880 1:10260096-10260118 GAGTGTACTTACACAAACCCTGG + Intronic
902689853 1:18104168-18104190 AAGTGTACACACACAAACACAGG - Intergenic
903982096 1:27196440-27196462 GAGTGTACTTACACAAACCTAGG - Intergenic
904491654 1:30864141-30864163 GAGTGTCCTTACACAAACCAAGG - Intergenic
907322081 1:53609786-53609808 GAATGTACTTACACAAACCTAGG + Intronic
908500360 1:64737475-64737497 GAATGTACATACACAAACCTAGG - Intergenic
908729749 1:67213714-67213736 GATTGTAATTACACAAACCTGGG - Intronic
908942201 1:69448744-69448766 GAGTATACATACACAAACCTAGG - Intergenic
909004511 1:70259055-70259077 GGGTGTACTTACACAAACCTAGG - Intergenic
909045851 1:70708548-70708570 GAATGTAGTTACACAAACCTAGG - Intergenic
909486804 1:76183592-76183614 AAGTGTACTTACACAACCCTAGG + Intronic
910143049 1:84047820-84047842 GAATATACTTACACAAACCTAGG + Intergenic
910667080 1:89737269-89737291 AAACCTACTTACACAAACCTAGG + Intronic
911245742 1:95514936-95514958 GAGTGTATTTACACAAACCTAGG + Intergenic
911545220 1:99208110-99208132 GAGTATACCAACACAAACCTAGG + Intergenic
911809013 1:102249923-102249945 AAATGAAGTCAAACAAACCTTGG + Intergenic
912055340 1:105590630-105590652 GGATGTACTTACACAAACCTAGG + Intergenic
912221121 1:107676675-107676697 AATTGAACTGACCCAAACCTAGG + Intronic
915797492 1:158752265-158752287 AAGTGTAGCCACCCAAACCACGG - Intergenic
917169873 1:172159864-172159886 GAGTGTATTTACACAAACCTAGG + Intronic
917487878 1:175471386-175471408 GAATGCACTTACACAAACCTAGG + Intronic
918934575 1:190904532-190904554 CAGTGTACTTGCACAAACCTAGG - Intergenic
919176267 1:194022291-194022313 GAGTGTACTTTCACAAACCTAGG - Intergenic
919378359 1:196821854-196821876 GAGTGGACTTACACAAACCTAGG + Intronic
919383472 1:196888029-196888051 AAGTGCACTACCACAAAGCTAGG - Exonic
919388053 1:196945891-196945913 GAGTGGACTTACACAAACCTAGG + Intronic
920037231 1:203074231-203074253 GAATGTACTTACACAAACCTAGG + Intronic
920328721 1:205188356-205188378 GAGTGTACTTACACAAACTTAGG + Intronic
921172800 1:212564200-212564222 GAGTGTACTTACACAAACCTAGG - Intergenic
921211076 1:212898754-212898776 AAGTGTACTTACACAAACCTAGG + Exonic
921788820 1:219265700-219265722 GAGTGTACTTTCACAAACCTAGG + Intergenic
922375160 1:224956544-224956566 GAGTGCACTTACACAAACCTAGG - Intronic
922671954 1:227516518-227516540 GAATGTACTTACACAAACCTAGG + Intergenic
924183289 1:241460930-241460952 AAGTGAACTCACAGAATCATTGG + Intergenic
924292327 1:242549675-242549697 GAGTGAATTTACACAAACCTAGG + Intergenic
924304816 1:242676930-242676952 GAGTGTACCTACACAAAACTGGG + Intergenic
924821924 1:247501182-247501204 GGATGTACTTACACAAACCTAGG + Intergenic
1062828511 10:588890-588912 AACTGAACTCACACAAACGTGGG - Intronic
1063125235 10:3131271-3131293 CAGTGAACTCACACAAACCCAGG - Intronic
1063502281 10:6566220-6566242 AAGTGCAGTCCCACAAACATGGG - Intronic
1064187592 10:13175834-13175856 AACTGTACTTAGTCAAACCTAGG - Intronic
1064966248 10:21018169-21018191 AAGAGGACTAACACACACCTTGG - Intronic
1065135860 10:22669348-22669370 GAGTGTACTCACATGACCCTAGG - Intronic
1065781356 10:29171158-29171180 GAGTGTACTTACACAAACCTAGG + Intergenic
1065783069 10:29188821-29188843 GAGTGTACTTACACAAACCAAGG - Intergenic
1065809240 10:29426210-29426232 GAGTGTACTTACACAAACCAAGG - Intergenic
1066169946 10:32831046-32831068 GAGTATACTTACACAAACCTAGG + Intronic
1066276292 10:33871730-33871752 AAGTGTACTCACTTAAACAGAGG - Intergenic
1066360828 10:34729093-34729115 GGGTGAACTTACACAAACCTAGG - Intronic
1066637901 10:37524997-37525019 AAGTCAACTTACACAAACTTAGG + Intergenic
1067775740 10:49163651-49163673 CAGTGGACTGACACAAACTTGGG + Intronic
1068065397 10:52124252-52124274 GAGTCTACTCACACAAACCTAGG + Intronic
1068561152 10:58515339-58515361 GAGTGTAGTTACACAAACCTAGG + Intronic
1068804759 10:61183120-61183142 AAATGTAGTCACTCAAACATTGG - Intergenic
1068941146 10:62682733-62682755 AAGTGTGATCACACCAAGCTTGG + Intergenic
1069125748 10:64630405-64630427 GAGTGTACTTACACAAATATAGG - Intergenic
1069185345 10:65415459-65415481 GAGTGTAATTACACACACCTAGG + Intergenic
1069497526 10:68919100-68919122 GAGTGTACTTACACAAACCTAGG - Intronic
1069958393 10:72065466-72065488 AGGAGTACTTACACAGACCTTGG - Intronic
1070084723 10:73225970-73225992 GAGTGTATTTACACAAACCTAGG - Intronic
1071200337 10:83214945-83214967 GAGTGTACTTAAACAAACCTAGG + Intergenic
1072929640 10:99650777-99650799 AAGTGCTCTCACACACCCCTGGG - Intergenic
1073162353 10:101409520-101409542 TAGTGTACTTACACAAACCTAGG + Intronic
1073210188 10:101794251-101794273 AAGTTGACTCAGACAAACTTGGG - Intronic
1074913453 10:117933528-117933550 GAGTGTCCTTACACAAACCTAGG - Intergenic
1074993750 10:118736990-118737012 GGGTATACTTACACAAACCTAGG - Intronic
1075798873 10:125140077-125140099 AAGTGTCCTCACACTACACTGGG + Intronic
1076766555 10:132637878-132637900 AATTGTACACACACAAACTGAGG - Intronic
1077361613 11:2143277-2143299 AAATCTATTCACACTAACCTGGG - Intronic
1077861472 11:6184920-6184942 GAGTGTACTTACACCAACCTAGG - Intergenic
1079285634 11:19128950-19128972 ATGTGTATTTACACAGACCTGGG - Intronic
1079828258 11:25226914-25226936 CAGTGTGCTTACACAAACCTAGG - Intergenic
1079972451 11:27052778-27052800 AAGTGTTTTCACAGAACCCTGGG + Intronic
1080003439 11:27378052-27378074 GAGTATGCTTACACAAACCTCGG - Intronic
1080347971 11:31346703-31346725 TATTGTACTCACATATACCTCGG - Intronic
1080511559 11:32978954-32978976 TAGTGTACTTACACAAACCTAGG + Exonic
1081472277 11:43386327-43386349 GAGTGTACTTACACAAACCTAGG + Intronic
1082190135 11:49233081-49233103 AAGTTAACTCACACAAAGCCAGG - Intergenic
1082682486 11:56193304-56193326 CACTGTACTCACATAAACCCAGG - Intergenic
1084135468 11:67176602-67176624 GAGTGTACTTACACAAACCTGGG + Intronic
1084293390 11:68192101-68192123 GAGTGTACTTACACAAACCTAGG - Intronic
1084976676 11:72803921-72803943 CAGTGTACTTACACAAACAGAGG + Intergenic
1085949631 11:81314555-81314577 AAGTGTGCTTACACAAACCTAGG + Intergenic
1086293805 11:85341765-85341787 GAGTGTACTTACACAAGCCTAGG + Intronic
1086796170 11:91105843-91105865 GAATGAACTTACACAAACCTAGG + Intergenic
1087114153 11:94506013-94506035 GAATGCACTTACACAAACCTAGG - Intergenic
1087467625 11:98529241-98529263 GAGTGTACTTACACAAAACTAGG + Intergenic
1087550426 11:99640756-99640778 GAGTATACTTACACAAACCTAGG - Intronic
1087903422 11:103668370-103668392 AAGTGTAGTGGCACAATCCTAGG - Intergenic
1088102904 11:106174876-106174898 GCGTGTACTTACACAAACCCAGG + Intergenic
1088369460 11:109073521-109073543 AAGGGTACTGAAACCAACCTGGG + Intergenic
1089050588 11:115542043-115542065 GAGTCAACTTACACAAACCTGGG - Intergenic
1089564290 11:119363021-119363043 AAGTGTGAAGACACAAACCTCGG - Intronic
1089577341 11:119454653-119454675 GAGTGTACTCACTCAAACCCAGG - Intergenic
1089803593 11:121061511-121061533 GAGTATACTTACACAAACCTAGG + Intronic
1089948516 11:122503107-122503129 GAGTATACTTACACAAACCTAGG - Intergenic
1090603625 11:128398241-128398263 GAGTGTACTTACACAACTCTAGG - Intergenic
1091084012 11:132703153-132703175 GAGTATACTCACACAAGCCTAGG + Intronic
1092665273 12:10790441-10790463 TAGTGTACTCACAAAAACCTAGG + Intergenic
1093810598 12:23487909-23487931 GAGTGGGCTTACACAAACCTAGG + Intergenic
1093849676 12:24020309-24020331 GAGGTTACTAACACAAACCTGGG + Intergenic
1093956432 12:25224788-25224810 GAATATACTTACACAAACCTTGG - Intronic
1094247702 12:28320058-28320080 AAATGTATTCACATAAACCTTGG - Intronic
1094397781 12:30026206-30026228 GAGCGGACTTACACAAACCTAGG - Intergenic
1094446562 12:30537144-30537166 GAGTGCACTTACACAAATCTAGG + Intergenic
1094812628 12:34153877-34153899 GAATGTACTCACACAAACCTAGG - Intergenic
1096140219 12:49236680-49236702 GAGTGCACATACACAAACCTAGG + Intronic
1096452882 12:51759255-51759277 GAGTGTACTTACACAAACCTAGG - Intronic
1096937129 12:55293335-55293357 AAGTGTACTTCCAGGAACCTAGG - Intergenic
1098159453 12:67635305-67635327 GAGTGCACTTACACAAACCTGGG + Intergenic
1098809321 12:75065705-75065727 GAGTGTACTCACATAAACCTAGG - Intronic
1099172636 12:79383161-79383183 GAGTGTATTTGCACAAACCTAGG + Intronic
1099690051 12:85940348-85940370 GAGTGTATTTACACAAATCTAGG + Intergenic
1102942089 12:116952243-116952265 GAGTGTTCTTACACAAACCCAGG - Intronic
1105888641 13:24665171-24665193 GCATGTACTCACACAAACCCAGG - Intergenic
1106417346 13:29557391-29557413 GAGTGTACTGACAGAAACCTAGG + Intronic
1106487293 13:30183128-30183150 AAGTGTCCTCACATAAACCTAGG + Intergenic
1106711680 13:32342566-32342588 GAGTATACTTACACAAACCTAGG + Intronic
1107087910 13:36445934-36445956 GAGTGTACTCACACAAACCTCGG - Intergenic
1107268855 13:38590669-38590691 GGGTGCACTTACACAAACCTAGG - Intergenic
1108234291 13:48386275-48386297 GAGTGTGCTTACACAAACCTAGG + Intronic
1108361854 13:49675143-49675165 GAGTGTATTCACACAAACCTAGG + Intronic
1108859325 13:54834419-54834441 GTGTGTACTTAAACAAACCTAGG + Intergenic
1109052925 13:57507607-57507629 GAGTACACTCACACAAACTTAGG - Intergenic
1109264011 13:60175830-60175852 GAGTGCATTTACACAAACCTAGG - Intergenic
1109505325 13:63293468-63293490 GAATGTACTTACACAAACTTAGG + Intergenic
1109556680 13:63985302-63985324 GAGTGTACTTACACCAACATAGG + Intergenic
1109988141 13:70016919-70016941 AGCTGGACTCACACAGACCTGGG + Intronic
1110104165 13:71649245-71649267 GAGCGTACTTACACAAACCTAGG - Intronic
1110720205 13:78752782-78752804 AGGTGGAGTCACACAAACCCAGG - Intergenic
1110802875 13:79720657-79720679 GAGTGTACTTACGCAAACCTAGG + Intergenic
1111061439 13:83024172-83024194 GAGTGTACTTACACAAACGTAGG - Intergenic
1111133685 13:84010398-84010420 GAGTGTACTTCCACAAACCTAGG - Intergenic
1111216976 13:85156655-85156677 GAGTGTACTTACACAAGCCAAGG - Intergenic
1111427098 13:88100691-88100713 AACTGTCCTAACACAACCCTGGG + Intergenic
1111782551 13:92746895-92746917 GAGTGTACTTACACAAACCTAGG + Intronic
1112130058 13:96513753-96513775 GAGTGTACTTACACAAACTAAGG + Intronic
1112315618 13:98359786-98359808 CAGTGAACTTACACACACCTAGG - Intronic
1113236821 13:108285404-108285426 GAGCATACTTACACAAACCTAGG + Intronic
1114973958 14:28070701-28070723 AAGTGTACTTACACAAACGTAGG + Intergenic
1115310645 14:31974925-31974947 AAGTGTACGCACACCCAGCTGGG + Intergenic
1115666643 14:35556943-35556965 AAATGTATTTACACAAACTTTGG - Intronic
1115836911 14:37416398-37416420 GAGTGTATTTACACAAACCTAGG + Intronic
1115857149 14:37642722-37642744 TAGTGTACTTACACAAACCTAGG + Intronic
1116499200 14:45599797-45599819 GAGTATACTCACACAAACCTAGG - Intergenic
1116753375 14:48915197-48915219 GAGTGTACTTACATGAACCTAGG + Intergenic
1117110228 14:52445825-52445847 GAGTGTACTTACAGAAATCTAGG - Intronic
1117863361 14:60117459-60117481 GAGCGTACATACACAAACCTAGG - Intronic
1118354470 14:65001437-65001459 GAGTATACTCACACCAACCTGGG - Intronic
1118524862 14:66628297-66628319 AAATATGCTTACACAAACCTAGG + Intronic
1118529788 14:66690821-66690843 GAGTGTACTTACACAAACCGAGG - Intronic
1119783236 14:77292891-77292913 GTATGTACTTACACAAACCTAGG - Intronic
1120175382 14:81288318-81288340 GAGTGTAGTTACACACACCTAGG + Intronic
1120293222 14:82604731-82604753 CAGTGGACTTACACAAACCTAGG + Intergenic
1120678300 14:87449075-87449097 AAATGGACTCATATAAACCTGGG + Intergenic
1120783399 14:88507366-88507388 GAGTATACTTACACAAACCTAGG + Intronic
1121080701 14:91105813-91105835 GACTGTGCTTACACAAACCTGGG + Intronic
1123966259 15:25462119-25462141 GAGTGTGCTTACACAAACCTAGG - Intergenic
1123980232 15:25595451-25595473 CACTGTACTCACATAAAGCTAGG - Intergenic
1124447925 15:29755240-29755262 GAGTGTACTTACACAAACCTAGG - Intronic
1124716033 15:32062877-32062899 GAGTCTACTTACACAGACCTAGG + Intronic
1125753726 15:42048259-42048281 GAGTGTGTGCACACAAACCTAGG - Intronic
1127010188 15:54617069-54617091 AAGTGTACTTACACAAACCTAGG - Intronic
1127230523 15:56988254-56988276 GATTGTACTTACATAAACCTAGG + Intronic
1127936988 15:63650454-63650476 CATTGTACTCACTCCAACCTGGG - Intronic
1128789777 15:70424500-70424522 GAGTGTACTTACTCTAACCTAGG - Intergenic
1131736855 15:95341929-95341951 GAGTGCACTTACACAAACCTAGG + Intergenic
1131998992 15:98161287-98161309 GAGTGCACTTACACAAAGCTAGG + Intergenic
1132421087 15:101669777-101669799 GAGTGTGCTTACGCAAACCTGGG - Intronic
1133410732 16:5566337-5566359 ATGTATAATCACACAAACATCGG + Intergenic
1133923407 16:10175161-10175183 GAGTGCACTTACACAAACCTAGG - Intronic
1134000929 16:10782222-10782244 AAGTGAACTCACTGCAACCTTGG + Intronic
1136017953 16:27417597-27417619 GAGTGCACTTACACAAACCTAGG + Intronic
1136535869 16:30899091-30899113 GAGTGTATTTACACAAACCTAGG - Intronic
1137005513 16:35271783-35271805 AGGGGTACTCACTCAAACTTTGG - Intergenic
1137278582 16:46954775-46954797 GAGTGTACTTCCACAAACCTAGG - Intergenic
1137345864 16:47658707-47658729 GAGTGTACTTACACAAACGTAGG - Intronic
1137382639 16:48013197-48013219 TAGTATACTCAAAGAAACCTGGG - Intergenic
1137751001 16:50861053-50861075 ATGTGTACACACACACACATAGG + Intergenic
1138310997 16:56023927-56023949 AAGTGTACTGACTCAAAGTTTGG - Intergenic
1139743839 16:69058613-69058635 AAGTGTATTAGGACAAACCTGGG + Intronic
1139790870 16:69433842-69433864 GAGTATATTTACACAAACCTAGG + Intronic
1140418309 16:74793817-74793839 GTATGTACTTACACAAACCTAGG + Intergenic
1142662425 17:1440385-1440407 CAGTGTACTCACAAACTCCTAGG - Intronic
1142931501 17:3288439-3288461 GAATGTACTTGCACAAACCTAGG - Intergenic
1143206233 17:5141195-5141217 GAGTGTACCTACACAAACCTAGG - Intronic
1143932246 17:10441052-10441074 AAGTGTACACACAGAGAACTAGG - Intergenic
1146553447 17:33802321-33802343 GAGTCTACTGACACAAACTTAGG - Intronic
1146899560 17:36574306-36574328 GAGTGTACTTACACAAACCTAGG - Intronic
1146906508 17:36621635-36621657 AAGTGTACTCACAGCAAATTTGG - Intergenic
1147620096 17:41860628-41860650 CATTGCACTCACTCAAACCTAGG - Intronic
1147640511 17:41995652-41995674 AAGTATACTTACACAAACCTGGG - Intronic
1148174516 17:45552018-45552040 GCGTATACTTACACAAACCTAGG + Intergenic
1148274751 17:46293429-46293451 GCGTATACTTACACAAACCTAGG - Intronic
1148296854 17:46511008-46511030 GCGTATACTTACACAAACCTAGG - Intergenic
1149280468 17:55099383-55099405 TATTGTATTCAAACAAACCTAGG + Intronic
1149874008 17:60212300-60212322 GAGTGTACCTACACAAACCTAGG + Intronic
1150087787 17:62289568-62289590 GAGTGTACCTACACAAACCTAGG + Intergenic
1150405735 17:64898940-64898962 GCGTATACTTACACAAACCTAGG + Intronic
1150405844 17:64899808-64899830 AACTGTAGTAACACAATCCTCGG + Intronic
1151072418 17:71230936-71230958 GAGTGCACTTACACAAACCTAGG - Intergenic
1153298350 18:3570116-3570138 GAAGGTACTTACACAAACCTGGG - Intronic
1154339151 18:13488816-13488838 AAGTGTCCTCGCACAAACTGGGG + Intronic
1155269926 18:24130702-24130724 TAGAGTACTTACACAGACCTAGG + Intronic
1155310905 18:24522409-24522431 AATTGTACTCACACAGAATTTGG - Intergenic
1155822956 18:30401418-30401440 GAGTGTACTTACACAAACCTAGG - Intergenic
1157532903 18:48437112-48437134 GAGTGTACTTACACAAACCTAGG + Intergenic
1157939628 18:51913482-51913504 AAGTGTGCTCAAATAAAACTAGG + Intergenic
1158941331 18:62407827-62407849 GAGTGTTCTCACACAATCCTAGG + Intergenic
1158952650 18:62509190-62509212 GAGTATACTTATACAAACCTAGG + Intergenic
1160457431 18:79012463-79012485 GAGTGTCCTTACCCAAACCTGGG - Intergenic
1162034012 19:7929574-7929596 AAGTGTGATCACAGAAACCAGGG - Intronic
1165648245 19:37463381-37463403 GAGTGTACTTATATAAACCTAGG - Intronic
1166611479 19:44202969-44202991 CAGTGTACTCACACAATACGTGG - Intergenic
1166743278 19:45127042-45127064 TAGTGGACTTACACAAACCTAGG + Intronic
1167654061 19:50751936-50751958 GAGTGTGCTTACACAAACCTAGG - Intergenic
1168478492 19:56696298-56696320 GAGTGTACTTACACAAACCTTGG + Intergenic
925911748 2:8578326-8578348 AGGAGTCCTCACCCAAACCTAGG - Intergenic
926436896 2:12847405-12847427 AGGTGTACTTAAACAAACCTAGG + Intergenic
927531893 2:23813525-23813547 AAGTGTTCTGAGACAAGCCTGGG + Intronic
927732254 2:25484145-25484167 GAGTGTACTTACACAAACCTAGG - Intronic
928152883 2:28848008-28848030 TAGTGTACTTACACAAACCTAGG - Intronic
928164480 2:28959892-28959914 GAGTGCACTGACATAAACCTGGG + Intronic
928874537 2:36022364-36022386 AGGTGTGCTTACACAAACCTAGG - Intergenic
929583060 2:43096255-43096277 GAGTGTACTTACACAAACTTAGG - Intergenic
929767408 2:44857848-44857870 GAGTGTACGTACCCAAACCTAGG - Intergenic
930490776 2:52067553-52067575 GAGCATACTTACACAAACCTAGG - Intergenic
930736752 2:54787400-54787422 AATTGTAGTCATACAGACCTAGG + Intronic
930901403 2:56511448-56511470 AAGTAAACACACACCAACCTGGG - Intergenic
930975831 2:57459705-57459727 AAGTATGCTCCCACAAACCTAGG + Intergenic
931768547 2:65478125-65478147 AAGTGTACAAGGACAAACCTTGG - Intergenic
932141702 2:69284305-69284327 GAGTGTACTTACACAAACCTAGG - Intergenic
933425021 2:82099662-82099684 GAGTGTACTTACACAAACCTAGG - Intergenic
933844003 2:86310458-86310480 GAGTGTACTTACACAAACCTAGG - Intronic
934877093 2:97933106-97933128 GAGTGTACCTACACAAACCTAGG - Intronic
935071633 2:99699647-99699669 AAGAGTTCTCCCATAAACCTGGG - Intronic
935083260 2:99820177-99820199 GAGTGCACTTACACAAACCTGGG + Intronic
936748995 2:115617698-115617720 GAGTGTACTTACACAAACCTAGG - Intronic
937595730 2:123670500-123670522 GAGTGTACTTACACAAATCTAGG + Intergenic
937704914 2:124909397-124909419 GAGTGTGCTCACACAATCCTAGG - Intronic
937711126 2:124981302-124981324 ACGTGTGCACACACAAACATGGG - Intergenic
938113311 2:128585718-128585740 GAGTGTACTTACACAAACATAGG + Intergenic
938710411 2:133971722-133971744 GAGTGTACTCACACAAACCTAGG + Intergenic
939658948 2:144863510-144863532 CATTGGAATCACACAAACCTGGG + Intergenic
940227727 2:151417814-151417836 AAGAGGACTTACACAAACCTAGG + Intronic
940354736 2:152727790-152727812 GAGCGTACTTACAAAAACCTAGG - Intronic
940471482 2:154105547-154105569 GAGTGTACTTACATAAATCTAGG - Intronic
941470338 2:165877579-165877601 GAGTATACTTACACAAACCTAGG - Intronic
942049436 2:172125206-172125228 GAGTGTACTTACACAAACCTAGG - Intergenic
942658766 2:178242025-178242047 GAGTGCACTTACACAAATCTAGG - Intronic
942881428 2:180866136-180866158 AAGTATACTTACACAAACCTAGG + Intergenic
942920612 2:181369211-181369233 GAGTGTACTCACACAAACCCAGG - Intergenic
943206452 2:184903496-184903518 GAGTGTACTTACACAAACCTAGG - Intronic
943261233 2:185666098-185666120 AAATGTACTTACATAAACCTAGG + Intergenic
943702887 2:191005608-191005630 GAGTGCACTTACACAAACCCAGG - Intronic
944388660 2:199193585-199193607 GAGTGTACTTACACAACCCTAGG - Intergenic
944827402 2:203499036-203499058 AATTGTACTTACACAAACCCAGG - Intronic
944899485 2:204199662-204199684 GGCTGTACTTACACAAACCTAGG + Intergenic
945703953 2:213205620-213205642 TGGTGTACTCAGACAAATCTGGG - Intergenic
946233995 2:218311019-218311041 GTGTGTACTTACACAAACCTAGG - Intronic
947047199 2:226001302-226001324 GAATGTACTTACACAAACCTAGG + Intergenic
948330204 2:237158482-237158504 GAGTGTACTTACACAAACCTAGG - Intergenic
1168901793 20:1371108-1371130 AAGTGTCCTCACCCAGGCCTTGG + Intronic
1169181220 20:3569257-3569279 GAGTGTACTTACATAAACTTAGG + Intronic
1170910058 20:20557392-20557414 AAATGTGCACACACAAACATAGG + Intronic
1172492777 20:35354110-35354132 GAGTATACTTACACAAACCTCGG - Intronic
1172892389 20:38275818-38275840 CAGTGTACTTACACAAACCTAGG + Intronic
1173117667 20:40261411-40261433 GAGTGTATTTACACAAACCTAGG - Intergenic
1173247268 20:41345285-41345307 CAGTGGAACCACACAAACCTGGG + Intronic
1174238739 20:49115770-49115792 CAGTGCACTCACACAGACATTGG + Exonic
1174491510 20:50900349-50900371 AAGGGTACTTACACAGACCTAGG - Intronic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1177082742 21:16661356-16661378 ATGTGTTCTCACTCAAAACTGGG - Intergenic
1179323340 21:40314695-40314717 CAGCATACTCAGACAAACCTTGG + Intronic
1179972092 21:44841761-44841783 GAGTGCACGCACACACACCTAGG + Intergenic
1181111765 22:20606626-20606648 AAGTGTTGTCACAGAGACCTTGG - Intergenic
1182979788 22:34658022-34658044 GAGTGCACTTACACAAACCTAGG + Intergenic
1183118098 22:35707420-35707442 GAGTATATTTACACAAACCTAGG - Intergenic
1184973411 22:48043722-48043744 GGGTGCACTCACACACACCTGGG + Intergenic
949123267 3:413336-413358 AAGTGAGCTCACACAAAATTTGG - Intergenic
949418755 3:3841975-3841997 GAGTATACTTACATAAACCTAGG + Intronic
949780113 3:7676863-7676885 TAATGTACTGACACAAATCTTGG - Intronic
950852200 3:16072873-16072895 AAGTACACTTACACAAACCTAGG - Intergenic
951067241 3:18280926-18280948 GAGTGTACTCACACAAATGTAGG - Intronic
951527300 3:23665690-23665712 GAGTGTACTTACACAAACCTTGG + Intergenic
952639953 3:35581306-35581328 AAGCTTACTGAAACAAACCTTGG + Intergenic
953678556 3:45022178-45022200 GAGTGTACTTACACAAACCTAGG + Intronic
954323414 3:49847471-49847493 AAGTGAACTCGCACAAGGCTTGG + Intronic
954829196 3:53404212-53404234 CAGTGTTCTCACACACACCAGGG - Intergenic
956783851 3:72625885-72625907 GAGTGCACTTACACAAACCTAGG + Intergenic
956863190 3:73344902-73344924 GATTGTACTCACACAAACCTAGG + Intergenic
957021121 3:75127764-75127786 GAGTGTACTTACACAAACCTAGG - Intergenic
957122738 3:76116780-76116802 ACCTGTGCTCACACAAAGCTTGG - Intronic
957315968 3:78577308-78577330 GAGTGTACTTACACAAGCCTAGG - Intergenic
957331169 3:78766397-78766419 ATTTGTACTCACATAAAGCTTGG + Intronic
957481301 3:80799462-80799484 AACTGTACAAATACAAACCTGGG + Intergenic
957594873 3:82250684-82250706 GATTGTACTTATACAAACCTAGG - Intergenic
957633548 3:82750716-82750738 GAATGTATTTACACAAACCTAGG + Intergenic
957960823 3:87249046-87249068 GAGTATACTTACATAAACCTAGG + Intronic
958168648 3:89910674-89910696 GAGTGTACTTACAAAAATCTAGG + Intergenic
958546408 3:95557953-95557975 CAGTGTACTTACATAGACCTAGG + Intergenic
959204679 3:103290977-103290999 GAGTGTACTTATACAAATCTAGG - Intergenic
959515163 3:107257833-107257855 AAGTGTCATCACACAAAAATGGG - Intergenic
959918877 3:111848944-111848966 GAGTCCACTTACACAAACCTAGG - Intronic
959940747 3:112078251-112078273 AAGTGTACACACACATACCCAGG - Intronic
961666198 3:128494319-128494341 AAGTGCACACAGACACACCTGGG - Intergenic
961999907 3:131285043-131285065 AAGTGTACTCACAGAAGATTTGG - Intronic
962028843 3:131577400-131577422 GAGTATACTTACACAAACCTAGG + Intronic
962949278 3:140203164-140203186 AAGTGTACTCTGACAAAGATAGG + Intronic
963349620 3:144136665-144136687 AAGTGTAGTCACAGCAAGCTAGG - Intergenic
964143186 3:153426977-153426999 GAGTACACTTACACAAACCTAGG - Intergenic
964592576 3:158381584-158381606 GAGTGTAGTTATACAAACCTAGG + Intronic
964600376 3:158494149-158494171 GAGTATACTCTCACAAACCTAGG + Intronic
964770165 3:160216345-160216367 GAGTGTACTTACACAAATCTAGG + Intergenic
965030839 3:163365606-163365628 AAGAGTAGCCACTCAAACCTAGG - Intergenic
966178081 3:177161090-177161112 AAATGTACACAAACACACCTAGG + Intronic
967547209 3:190745356-190745378 GATTGTACTTACACAAACCTGGG - Intergenic
969396071 4:6922284-6922306 GACTCTACTCACTCAAACCTCGG + Intronic
969937262 4:10694621-10694643 GAGTGTATTTACACAAACCTAGG - Intergenic
970310247 4:14775469-14775491 AAATAAACTCACACAACCCTGGG - Intergenic
970512029 4:16790540-16790562 GAGTGTACGTACACAAACCTAGG - Intronic
970672973 4:18417399-18417421 GAGTGTACTTACACAAACCTAGG + Intergenic
970797593 4:19932060-19932082 GAGTATACTTACAGAAACCTGGG + Intergenic
971212022 4:24627534-24627556 GAGTGTACTTACATCAACCTAGG + Intergenic
971363960 4:25961219-25961241 CAGCGTACTTACACAAGCCTAGG + Intergenic
972058900 4:34841757-34841779 AAGTGTTCTCACAAAAAAATAGG - Intergenic
972423653 4:38912687-38912709 ATGTGGACTCACTCAAAACTGGG - Intronic
973725282 4:53769564-53769586 GAGCATACTGACACAAACCTAGG - Intronic
973953862 4:56043353-56043375 GAGTGTACTTACACAAACCTAGG + Intergenic
974012174 4:56617134-56617156 GAGTGTACTTGCGCAAACCTAGG + Intergenic
974139733 4:57870234-57870256 GAGTGTACTTACACAAACCTAGG - Intergenic
974229812 4:59095296-59095318 CAGTGTACTTACATAAACCTTGG - Intergenic
974259705 4:59510076-59510098 GAGTGTACTTACCTAAACCTAGG + Intergenic
974462756 4:62209068-62209090 AATTGGACTCACACAAATCTGGG - Intergenic
975077659 4:70232501-70232523 GAGTGTCCTTACACAAACCTAGG - Intronic
975346987 4:73303143-73303165 GAGTGTACTTACACAAATTTAGG + Intergenic
975709716 4:77148395-77148417 GAGTGTACTTACACAAATTTTGG + Intergenic
976628526 4:87212878-87212900 GAGTATACTTACACAAACCTAGG - Intronic
977606564 4:98990426-98990448 AAGTGTCCTTACACAAACCTAGG + Intergenic
977779848 4:100968200-100968222 GAGTGTACTTACACAAACCTAGG - Intergenic
977784729 4:101019471-101019493 AGGTGTAGTCAGAAAAACCTAGG - Intergenic
977855504 4:101885809-101885831 CAGTGTACTTATCCAAACCTAGG + Intronic
978229358 4:106379798-106379820 GAGTGTACTTACACAAATCTAGG - Intergenic
978295307 4:107198085-107198107 GAGTGTACTTACATAATCCTAGG + Intronic
978624882 4:110673967-110673989 GAGTGTACTTACACAAACCTAGG - Intergenic
978788737 4:112638694-112638716 TGATGTATTCACACAAACCTAGG - Intronic
978854332 4:113376197-113376219 GAATGTCCTTACACAAACCTAGG + Intronic
979010428 4:115360630-115360652 AAGTGTACTGGCACAGAACTGGG + Intergenic
980578728 4:134720198-134720220 GAGTGTACTCACACAAACCTAGG - Intergenic
981798837 4:148632405-148632427 GAGTATACTCACACAAACCTAGG + Intergenic
983932511 4:173468369-173468391 GAGTGTACTTACACAAACCTAGG - Intergenic
984130906 4:175874966-175874988 CAGTATACACACACACACCTTGG - Intronic
984272401 4:177563320-177563342 AAGTGTACTTACACAAATCTAGG - Intergenic
984352365 4:178612326-178612348 GAGTGTACTTACATGAACCTAGG + Intergenic
986567826 5:9132698-9132720 AAGTAAACTTTCACAAACCTTGG - Intronic
987901379 5:24016548-24016570 GAATATACTTACACAAACCTAGG + Intronic
987998881 5:25323714-25323736 AAGTGTACTCATTCTAACCTTGG - Intergenic
989304438 5:39936271-39936293 GATTGTACTTACACAAACATAGG - Intergenic
990253140 5:53937698-53937720 GAGTGTACTTACACATACCCAGG - Intronic
990807815 5:59686115-59686137 AAGTGTACTCAGAGTAAACTTGG - Intronic
991400767 5:66249096-66249118 GAGTATACTTACACAAATCTAGG + Intergenic
991939096 5:71832936-71832958 GAGTGTACTTACACAAACCTAGG - Intergenic
992278434 5:75146363-75146385 AAGTGTTCTCATACAAGCCAGGG + Exonic
993954855 5:94219578-94219600 GAGTGGACCTACACAAACCTAGG + Intronic
994091699 5:95815308-95815330 AAGTGAACTCAGACAGACATAGG + Intronic
994210086 5:97078045-97078067 GAGTGGACTTACACAAACCTAGG + Intergenic
994560572 5:101365759-101365781 GTGTGTACTTACACAAACCCAGG - Intergenic
994638139 5:102368320-102368342 GAGTGTACTTATACAAACCTAGG - Intergenic
994640636 5:102404761-102404783 TAGTGTTCTCCCACAAAACTTGG - Intronic
995513014 5:112926623-112926645 AAATGTAGTGACAAAAACCTAGG - Intergenic
996168749 5:120261601-120261623 AAATGAACTGACACAAAACTAGG - Intergenic
996518910 5:124404568-124404590 GAATGTATTTACACAAACCTAGG - Intergenic
996571623 5:124938288-124938310 GAGTGTTCTTACACAAAACTAGG - Intergenic
996692660 5:126357303-126357325 AAGTGTTCTGACACCAAACTTGG + Intergenic
997729924 5:136162152-136162174 GAGTGCACTCACACACACCCCGG + Intronic
998212803 5:140213810-140213832 TAGTGTACTTACACAAACCTAGG - Intronic
998409724 5:141900464-141900486 AAGGTTCCTCACACAAAGCTTGG + Intergenic
998735548 5:145135589-145135611 CTGTGTACTCAGAAAAACCTGGG + Intergenic
998899068 5:146832868-146832890 GAGTGTACTTACACAAACCTGGG - Intronic
999110257 5:149113801-149113823 GAGTGTACTTTCGCAAACCTAGG - Intergenic
999437708 5:151576836-151576858 GAGTGCACTTACACAAACCTAGG + Intergenic
1002341742 5:178520983-178521005 GCATGTACTTACACAAACCTAGG + Intronic
1002371821 5:178760952-178760974 AAGTGAGCTCACACTTACCTGGG - Intergenic
1002803032 6:544622-544644 AACTGTACTCACTCACATCTAGG + Intronic
1002871958 6:1174859-1174881 GAGTGAACTTACACAAACCTAGG - Intergenic
1002980821 6:2135951-2135973 CAGTATACTTGCACAAACCTAGG + Intronic
1003676919 6:8213303-8213325 GAGTGTACTTACACAAATCTAGG + Intergenic
1003723647 6:8734094-8734116 TAGTGTACTCACACAGACATGGG + Intergenic
1005175609 6:23041096-23041118 ATGTATACTGACAGAAACCTAGG + Intergenic
1005698192 6:28371293-28371315 GAGTGTACTTACACAAACTTAGG - Intergenic
1006960263 6:37922602-37922624 GAGTGTCCTTACACAAACCTAGG + Intronic
1007427765 6:41758233-41758255 GAGTGCACTTACAGAAACCTAGG + Intergenic
1008067671 6:47067211-47067233 GAGTGTACCTACACAAACCTAGG - Intergenic
1008803427 6:55398052-55398074 GAGTGTACTTACACCAACCTGGG - Intronic
1009850447 6:69190945-69190967 GAGTGTACTAATACAAACCTGGG - Intronic
1010680477 6:78793150-78793172 AAGTGTACTCTCACATTGCTGGG - Intergenic
1012114887 6:95284610-95284632 GGGTATACTTACACAAACCTAGG - Intergenic
1012182909 6:96177051-96177073 AAGTGGCCTCTCACAAACCATGG - Intronic
1012183819 6:96188979-96189001 TCGTATACTCACACAAATCTAGG + Intronic
1012266540 6:97151416-97151438 GAGTGTACTTATACAAACCTAGG - Intronic
1013238431 6:108220549-108220571 GAGTATACTCACACAAACCCAGG - Intronic
1013828461 6:114243796-114243818 CAGTGTAATAAGACAAACCTGGG - Intronic
1013887869 6:114992233-114992255 GAGTGTATTTACACAAACCTAGG - Intergenic
1013968061 6:115979880-115979902 AAGTGTACTCACACAAACCTAGG - Intronic
1014978109 6:127914466-127914488 GAGTGTGCTTACACAAACCTAGG + Intronic
1015157974 6:130118688-130118710 AATTGGACCCATACAAACCTGGG - Intronic
1015425466 6:133060569-133060591 AAGTGAAATTACACAGACCTAGG - Intergenic
1015781231 6:136868186-136868208 GAGTGTACTTACACAAACCTAGG - Intronic
1016175290 6:141072015-141072037 AAGTGGGCTCACACAACCTTGGG - Intergenic
1016349222 6:143149006-143149028 GAGTGTACTTACACAAACCTAGG - Intronic
1016608234 6:145959491-145959513 GAGTATACTTACACAAACCTAGG - Intronic
1018558100 6:165071052-165071074 GAGTGTACTTAAACAAACCTAGG + Intergenic
1018916748 6:168137132-168137154 GAGTGCGCTTACACAAACCTGGG + Intergenic
1019990148 7:4684339-4684361 AAGTTTACAGACACAAACTTTGG - Intronic
1020995371 7:15256807-15256829 TACAGTACTTACACAAACCTAGG - Intronic
1021354565 7:19637895-19637917 AAGTATATTAACACAAACCTAGG + Intergenic
1021880311 7:25089034-25089056 CAGTGTACTTACACAAACCTAGG - Intergenic
1021905937 7:25333145-25333167 TGGTGTTCTCACACATACCTAGG - Intergenic
1022725453 7:32977359-32977381 GAGTGCACTTACACAATCCTAGG + Intronic
1023518618 7:41028496-41028518 GAGTGCACTTACACAAACCTAGG + Intergenic
1024269474 7:47631712-47631734 GAGTGCACTTACACAAACCGAGG - Intergenic
1024324697 7:48100099-48100121 GAGCGTAACCACACAAACCTAGG + Intronic
1024665061 7:51537809-51537831 GAGTGGACTTACACAAACCTAGG - Intergenic
1025048160 7:55710457-55710479 GAGTGCACTTACACAATCCTAGG - Intergenic
1026684279 7:72494919-72494941 AAGGGCACTCACACAGCCCTTGG - Intergenic
1027798668 7:82724475-82724497 GAGTGAACTTACACAAACCTAGG + Intergenic
1028681685 7:93542187-93542209 CAGTGTACTTACACAAACCTAGG + Intronic
1028870360 7:95764759-95764781 GAGTGTAGTTCCACAAACCTAGG - Intergenic
1029412660 7:100425561-100425583 AAGTGTAGTCCCAAAATCCTAGG + Intronic
1030200071 7:106893817-106893839 GAGTGAACTTACACAAACCTAGG + Intronic
1030481438 7:110109687-110109709 GAGCTTACTTACACAAACCTAGG - Intergenic
1031030138 7:116725578-116725600 GAGTGTACTTATACTAACCTAGG + Intronic
1031226496 7:119045219-119045241 GAGTGTACTTACACAAATCTAGG + Intergenic
1031316972 7:120270838-120270860 GAGCGTACTTACACAAACTTAGG - Intergenic
1031320988 7:120327311-120327333 AAGTTTTCACACACAAACTTAGG + Intronic
1031413594 7:121468809-121468831 GAGTTTACTTACACAAACTTAGG + Intergenic
1031507536 7:122604933-122604955 GAGTGTACTTATACAAACCTAGG + Intronic
1031846567 7:126812324-126812346 GACTGTACTTACACAAACCTAGG + Intronic
1031892015 7:127305534-127305556 GTGTGTACCTACACAAACCTAGG - Intergenic
1031936953 7:127745172-127745194 GTGCATACTCACACAAACCTAGG + Intronic
1032008718 7:128326605-128326627 TAGTGTACTTATACAAACCTAGG - Intronic
1032293358 7:130610928-130610950 AAGTGTCTTCACCTAAACCTGGG - Intronic
1032565608 7:132939546-132939568 GAGTGTACTTACACAACCCTAGG - Intronic
1033059531 7:138092506-138092528 GAGTGTACTTACACAAACCGAGG + Intronic
1033067528 7:138170467-138170489 AACAGTGCTCACACATACCTTGG + Intergenic
1033398498 7:140998975-140998997 GAGTGTACTTACACAAACCTAGG + Intergenic
1033679165 7:143576345-143576367 GAGTGTACTTACAGAAACCTAGG + Intergenic
1033692672 7:143753109-143753131 GAGTGTACTTACAGAAACCTAGG - Intergenic
1035936336 8:3845280-3845302 GAGTGAACTCACAGAAACCTAGG + Intronic
1035941016 8:3901092-3901114 AAGTATACACACATTAACCTTGG - Intronic
1037652884 8:20855766-20855788 ATATGTACACACACACACCTAGG + Intergenic
1037704053 8:21301607-21301629 GAGTGCACTTACACAAATCTAGG - Intergenic
1037870605 8:22492061-22492083 GAGTGTACTTACATAAACCTAGG + Intronic
1038597031 8:28896750-28896772 GAGTGTACTTACACAAGCCTAGG - Intronic
1039599401 8:38821826-38821848 AAGTGAACTTACTCAAACCTAGG + Intronic
1039626197 8:39057183-39057205 GAGTGCACTTAAACAAACCTAGG - Intronic
1040430070 8:47331330-47331352 GAGTGTTCTTACTCAAACCTAGG + Intronic
1040761696 8:50853375-50853397 ATGTGTACTCACACAGTTCTGGG - Intergenic
1042820242 8:72922704-72922726 AAGTGTCAACACACAAACTTTGG + Intronic
1043538686 8:81234543-81234565 CAATTTACTCACACAAACCATGG - Intergenic
1043695598 8:83212736-83212758 AAGTGTACTCTCAAAAATTTAGG + Intergenic
1043946951 8:86264317-86264339 GAGTGTACTTACACAAATCTAGG + Intronic
1044775371 8:95681512-95681534 AAGTGTACAGAAACTAACCTGGG + Intergenic
1044974364 8:97649122-97649144 TAGTATACTGACACAAACCTAGG - Intronic
1045484547 8:102621001-102621023 GAATGAACTTACACAAACCTAGG - Intergenic
1045618557 8:103947410-103947432 GAGTGCACTTACACAAGCCTAGG + Intronic
1046086219 8:109438934-109438956 AAATGAACTCACACAAAACATGG + Exonic
1046950132 8:120012298-120012320 GAGTGTACTTACACAAACCTGGG + Intronic
1046985324 8:120381629-120381651 CAGTGTACTTAAACAAACCTAGG + Intronic
1047822265 8:128534302-128534324 GAGTGGACTCACACAAACCTAGG - Intergenic
1048085769 8:131177521-131177543 AAGTGTATTTACACAAACCTAGG + Intergenic
1048089858 8:131227701-131227723 GAGTGTACTTACACAAATCTAGG + Intergenic
1048557116 8:135490134-135490156 GAGTGCACTTACACACACCTAGG - Intronic
1048562969 8:135562426-135562448 GAGTGTACTTACATAAACCTAGG - Intronic
1048929422 8:139299842-139299864 GAAGGTACTCACACAAACCTAGG + Intergenic
1050237838 9:3601020-3601042 AAGTGCACCCACACAACCTTTGG + Intergenic
1050770548 9:9193491-9193513 GAGTGTACTTACACAAACTTAGG + Intronic
1051369517 9:16346315-16346337 ACGTGTACACACACACTCCTGGG - Intergenic
1051647344 9:19281743-19281765 GAGTGTACATACACAAACCTAGG + Intronic
1052321861 9:27175967-27175989 AAATGTACTCTTATAAACCTGGG - Intronic
1052837654 9:33264045-33264067 AAGTGTACAGACACAAGCCCGGG + Intronic
1052838501 9:33270304-33270326 CAATGTATTTACACAAACCTAGG - Intronic
1053049592 9:34948660-34948682 AAGTGTACCTACACAAACCTAGG - Intergenic
1054913237 9:70473243-70473265 AAGTGTTCCCACATGAACCTGGG - Intergenic
1055938847 9:81629640-81629662 TAGTGTGTTTACACAAACCTGGG + Intronic
1056046983 9:82728992-82729014 ATGAGCACTCACAGAAACCTTGG + Intergenic
1057437722 9:95057833-95057855 AATGGGACTCACAGAAACCTGGG + Intronic
1058840685 9:108905696-108905718 TAGAGTACTTACACAAACCTAGG + Intronic
1059951558 9:119468291-119468313 GAGTGTACTTACACAAACTTAGG - Intergenic
1060362123 9:122969280-122969302 GAGTGTACTTACATAAACCCAGG - Intronic
1060868263 9:127017204-127017226 TTGTGTACTTACACAAACCTAGG + Intronic
1061321364 9:129832176-129832198 AAGTGTATCCACTCAATCCTTGG - Intronic
1185938203 X:4282867-4282889 GAGTGCACTTACACAAACCTAGG + Intergenic
1186013010 X:5158120-5158142 GAGTGCACTTACACAAACCTAGG - Intergenic
1186071992 X:5831607-5831629 GAGTGTACTTACACAAATCTAGG - Intergenic
1186316537 X:8376507-8376529 GAGTGGACTTTCACAAACCTAGG - Intergenic
1186764023 X:12752435-12752457 AAGTGCACTGAGACCAACCTCGG - Intergenic
1188442513 X:30226918-30226940 GAGTATACTTACATAAACCTAGG - Intergenic
1188595260 X:31892580-31892602 GTGTGTACCTACACAAACCTAGG + Intronic
1188777408 X:34237664-34237686 GAGTGCACTTACAAAAACCTAGG + Intergenic
1189329611 X:40135439-40135461 AAGTGTAGTGACACAATACTCGG + Intronic
1189887461 X:45562833-45562855 GAGTGCACTTACACAAATCTAGG - Intergenic
1189901745 X:45713518-45713540 CAGTGGAGTTACACAAACCTAGG + Intergenic
1190250126 X:48716981-48717003 AAATATACTCACACAGAGCTTGG + Intergenic
1191011558 X:55764727-55764749 GAGTATACGTACACAAACCTAGG - Intergenic
1192418492 X:71006597-71006619 TAGTGTATTTACACAAACCTAGG - Intergenic
1193153169 X:78145634-78145656 AAGAGTACTGCAACAAACCTGGG + Intergenic
1194413718 X:93585023-93585045 GAGTGTACTTACAGGAACCTAGG + Intergenic
1194496684 X:94624620-94624642 GAGTGTATTTACACAAACCTAGG + Intergenic
1194760566 X:97791482-97791504 AAATCATCTCACACAAACCTTGG + Intergenic
1197138208 X:123087469-123087491 AAGTATACTTGCACAAACCTAGG - Intergenic
1197599408 X:128510077-128510099 GAATGTACTTACACAAATCTAGG - Intergenic
1197645088 X:129008753-129008775 GAGTGTACTTACACAAACCTAGG + Intergenic
1198101252 X:133424035-133424057 AAGTGTACTCACTGAAAAGTGGG - Intergenic
1198333551 X:135644542-135644564 AAGTGCAGTCCCACAAAGCTGGG + Intergenic
1198432750 X:136584225-136584247 GAGTGCACTTACACAAACATAGG - Intergenic
1199117034 X:144005073-144005095 AATTTTACTCACACGTACCTAGG - Intergenic
1200404730 Y:2798211-2798233 AAGTGTATTTACAGAAACCTAGG - Intergenic
1200908062 Y:8505842-8505864 AATTGTACTCAAACAAATATTGG - Intergenic
1200952580 Y:8914638-8914660 AAGTGTACTCAAACAAATACTGG - Intergenic
1201523863 Y:14908801-14908823 GAGTGTACTTACACAAATCTAGG + Intergenic
1201601395 Y:15732114-15732136 TAGTTTTCTCACAGAAACCTAGG - Intergenic
1201643313 Y:16201262-16201284 ACGGGTACTCACTCAAACTTTGG + Intergenic
1201659502 Y:16384059-16384081 ACGGGTACTCACTCAAACTTTGG - Intergenic
1201747508 Y:17394721-17394743 GAGAGTACTTACACAAACATAGG + Intergenic
1201757716 Y:17504852-17504874 GAATGTACTTACACAAACCTAGG - Intergenic
1201843838 Y:18401130-18401152 GAATGTACTTACACAAACCTAGG + Intergenic
1202112084 Y:21432126-21432148 AAGTATACTCAAACAAATATTGG + Intergenic
1202127015 Y:21577502-21577524 AAATGTATTCTCACAAACCAGGG + Intergenic
1202160423 Y:21928939-21928961 AAGTGTACTCAAACAAATACTGG + Intergenic
1202230933 Y:22657436-22657458 AAGTGTACTCAAACAAATACTGG - Intergenic
1202312225 Y:23538729-23538751 AAGTGTACTCAAACAAATACTGG + Intergenic
1202558578 Y:26131865-26131887 AAGTGTACTCAAACAAATACTGG - Intergenic